EMAIL THIS PAGE TO A FRIEND

EIF3B

eukaryotic translation initiation factor 3, subunit B

82 Gene Product Result for
Synonyms: EIF3-ETA EIF3-P110 EIF3-P116 EIF3S9 PRT1
UniProtKB ID: P55884, A4D208, Q2NL77, Q9UMF9
Gene ID:
Mouse(27979) eukaryotic translation initiation factor 3, subunit B
Rat(288516) eukaryotic translation initiation factor 3, subunit B
sheep(101112875) eukaryotic translation initiation factor 3, subunit B
naked mole-rat(101701323) eukaryotic translation initiation factor 3, subunit B
domestic guinea pig(100732203) eukaryotic translation initiation factor 3, subunit B
chicken(769783) eukaryotic translation initiation factor 3, subunit B
cow(789999) eukaryotic translation initiation factor 3, subunit B
domestic cat(101091579) eukaryotic translation initiation factor 3, subunit B
dog(479766) eukaryotic translation initiation factor 3, subunit B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303095 ANTI-EIF3B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA048983 Anti-EIF3B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV40483 Anti-EIF3S9 antibody produced in rabbit affinity isolated antibody , mouse, rat, rabbit, guinea pig, bovine, horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037283 Rosetta Predictions human pricing
NM_003751 Rosetta Predictions human pricing
NM_001031640 Rosetta Predictions rat pricing
NM_133916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118318 predicted 1844
2 SASI_Hs01_00118319 predicted 1095
3 SASI_Hs01_00118320 predicted 954
4 SASI_Hs01_00118321 predicted 620
5 SASI_Hs01_00118322 predicted 1502
6 SASI_Hs01_00118323 predicted 620
7 SASI_Hs01_00118324 predicted 2217
8 SASI_Hs01_00118325 predicted 1209
9 SASI_Hs01_00118326 predicted 572
10 SASI_Hs01_00118327 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210060 predicted 1846
2 SASI_Hs01_00210061 predicted 1092
3 SASI_Hs01_00210062 predicted 946
4 SASI_Hs01_00210063 predicted 619
5 SASI_Hs01_00210064 predicted 1502
6 SASI_Hs01_00210065 predicted 617
7 SASI_Hs01_00210066 predicted 2224
8 SASI_Hs01_00210067 predicted 1205
9 SASI_Hs01_00210068 predicted 572
10 SASI_Hs01_00210069 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203571 predicted 463
2 SASI_Rn01_00051728 predicted 1958
3 SASI_Rn01_00051730 predicted 1271
4 SASI_Rn01_00051731 predicted 1203
5 SASI_Rn01_00051732 predicted 2009
6 SASI_Rn01_00051733 predicted 1488
7 SASI_Rn01_00051734 predicted 515
8 SASI_Rn01_00051735 predicted 652
9 SASI_Rn01_00051736 predicted 1296
10 SASI_Rn02_00203572 predicted 2447
11 SASI_Rn01_00051727 predicted 669
12 SASI_Rn01_00051729 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182981 predicted 515
2 SASI_Mm01_00182982 predicted 565
3 SASI_Mm01_00182983 predicted 1739
4 SASI_Mm01_00182985 predicted 705
5 SASI_Mm01_00182986 predicted 1808
6 SASI_Mm01_00182987 predicted 923
7 SASI_Mm01_00182988 predicted 1163
8 SASI_Mm01_00182989 predicted 2163
9 SASI_Mm02_00338989 predicted 1248
10 SASI_Mm02_00338990 predicted 859
11 SASI_Mm01_00182984 predicted 710
12 SASI_Mm01_00182990 predicted 1546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003751
VALIDATED
EIF3B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit B
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-647s1c1
Sequence:CCGGCGACCGACTTGAGAAACTCAACTCGAGTTGAGTTTCTCAAGTCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-2616s1c1
Sequence:CCGGGATTCTGCCATTGCGACACATCTCGAGATGTGTCGCAATGGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-1396s1c1
Sequence:CCGGGCATCTATGAAACTCCTTCTACTCGAGTAGAAGGAGTTTCATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-1844s1c1
Sequence:CCGGCAACGGGAAGATTGAACTCATCTCGAGATGAGTTCAATCTTCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-888s1c1
Sequence:CCGGGAGTGGGATATTCCAGAGAAACTCGAGTTTCTCTGGAATATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1847s1c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1666s1c1
Sequence:CCGGCCCAGGGTGTTGTCACAAATTCTCGAGAATTTGTGACAACACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003751.2-548s1c1
Sequence:CCGGCGAGGAAGAATTACTGGGAGACTCGAGTCTCCCAGTAATTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003751.2-887s1c1
Sequence:CCGGCGAGTGGGATATTCCAGAGAACTCGAGTTCTCTGGAATATCCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1622s1c1
Sequence:CCGGCGGAGACTACTTGTGTGTGAACTCGAGTTCACACACAAGTAGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1957s1c1
Sequence:CCGGCCTTAGCGTTTGTGGACACTTCTCGAGAAGTGTCCACAAACGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1874s21c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-674s21c1
Sequence:CCGGCGACCGACTTGAGAAACTCAACTCGAGTTGAGTTTCTCAAGTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1693s21c1
Sequence:CCGGCCCAGGGTGTTGTCACAAATTCTCGAGAATTTGTGACAACACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1649s21c1
Sequence:CCGGCGGAGACTACTTGTGTGTGAACTCGAGTTCACACACAAGTAGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1984s21c1
Sequence:CCGGCCTTAGCGTTTGTGGACACTTCTCGAGAAGTGTCCACAAACGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003751
VALIDATED
EIF3B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit B
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-647s1c1
Sequence:CCGGCGACCGACTTGAGAAACTCAACTCGAGTTGAGTTTCTCAAGTCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-2616s1c1
Sequence:CCGGGATTCTGCCATTGCGACACATCTCGAGATGTGTCGCAATGGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-1396s1c1
Sequence:CCGGGCATCTATGAAACTCCTTCTACTCGAGTAGAAGGAGTTTCATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-1844s1c1
Sequence:CCGGCAACGGGAAGATTGAACTCATCTCGAGATGAGTTCAATCTTCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-888s1c1
Sequence:CCGGGAGTGGGATATTCCAGAGAAACTCGAGTTTCTCTGGAATATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1847s1c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1666s1c1
Sequence:CCGGCCCAGGGTGTTGTCACAAATTCTCGAGAATTTGTGACAACACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003751.2-548s1c1
Sequence:CCGGCGAGGAAGAATTACTGGGAGACTCGAGTCTCCCAGTAATTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003751.2-887s1c1
Sequence:CCGGCGAGTGGGATATTCCAGAGAACTCGAGTTCTCTGGAATATCCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1622s1c1
Sequence:CCGGCGGAGACTACTTGTGTGTGAACTCGAGTTCACACACAAGTAGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1957s1c1
Sequence:CCGGCCTTAGCGTTTGTGGACACTTCTCGAGAAGTGTCCACAAACGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1874s21c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-674s21c1
Sequence:CCGGCGACCGACTTGAGAAACTCAACTCGAGTTGAGTTTCTCAAGTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1693s21c1
Sequence:CCGGCCCAGGGTGTTGTCACAAATTCTCGAGAATTTGTGACAACACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1649s21c1
Sequence:CCGGCGGAGACTACTTGTGTGTGAACTCGAGTTCACACACAAGTAGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1984s21c1
Sequence:CCGGCCTTAGCGTTTGTGGACACTTCTCGAGAAGTGTCCACAAACGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003751
VALIDATED
EIF3B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit B
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-647s1c1
Sequence:CCGGCGACCGACTTGAGAAACTCAACTCGAGTTGAGTTTCTCAAGTCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-2616s1c1
Sequence:CCGGGATTCTGCCATTGCGACACATCTCGAGATGTGTCGCAATGGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-1396s1c1
Sequence:CCGGGCATCTATGAAACTCCTTCTACTCGAGTAGAAGGAGTTTCATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-1844s1c1
Sequence:CCGGCAACGGGAAGATTGAACTCATCTCGAGATGAGTTCAATCTTCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003751.2-888s1c1
Sequence:CCGGGAGTGGGATATTCCAGAGAAACTCGAGTTTCTCTGGAATATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1847s1c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1666s1c1
Sequence:CCGGCCCAGGGTGTTGTCACAAATTCTCGAGAATTTGTGACAACACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003751.2-548s1c1
Sequence:CCGGCGAGGAAGAATTACTGGGAGACTCGAGTCTCCCAGTAATTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003751.2-887s1c1
Sequence:CCGGCGAGTGGGATATTCCAGAGAACTCGAGTTCTCTGGAATATCCCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1622s1c1
Sequence:CCGGCGGAGACTACTTGTGTGTGAACTCGAGTTCACACACAAGTAGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003751.2-1957s1c1
Sequence:CCGGCCTTAGCGTTTGTGGACACTTCTCGAGAAGTGTCCACAAACGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1874s21c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-674s21c1
Sequence:CCGGCGACCGACTTGAGAAACTCAACTCGAGTTGAGTTTCTCAAGTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1693s21c1
Sequence:CCGGCCCAGGGTGTTGTCACAAATTCTCGAGAATTTGTGACAACACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1649s21c1
Sequence:CCGGCGGAGACTACTTGTGTGTGAACTCGAGTTCACACACAAGTAGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003751.3-1984s21c1
Sequence:CCGGCCTTAGCGTTTGTGGACACTTCTCGAGAAGTGTCCACAAACGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133916
VALIDATED
EIF3B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133916.1-2534s1c1
Sequence:CCGGGCTGGGCTCTTACCTGTGCTTCTCGAGAAGCACAGGTAAGAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133916.1-1814s1c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-1350s1c1
Sequence:CCGGCTGGATACTCTTAGCATCTATCTCGAGATAGATGCTAAGAGTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-1536s1c1
Sequence:CCGGCGAGTGAGGAATTTGTTCAATCTCGAGATTGAACAAATTCCTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-879s1c1
Sequence:CCGGCCTTTCAAAGACCTGGGCAATCTCGAGATTGCCCAGGTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-565s21c1
Sequence:CCGGACGGGATTGACTCGGTGATTGCTCGAGCAATCACCGAGTCAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2282s21c1
Sequence:CCGGGATGGAGGACTTCCGGCAATACTCGAGTATTGCCGGAAGTCCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2197s21c1
Sequence:CCGGAGAAGTACTCCAAGATCTTTGCTCGAGCAAAGATCTTGGAGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-811s21c1
Sequence:CCGGTCAACCTCTTCACCGACTTTGCTCGAGCAAAGTCGGTGAAGAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2534s21c1
Sequence:CCGGGCTGGGCTCTTACCTGTGCTTCTCGAGAAGCACAGGTAAGAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133916
VALIDATED
EIF3B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133916.1-2534s1c1
Sequence:CCGGGCTGGGCTCTTACCTGTGCTTCTCGAGAAGCACAGGTAAGAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133916.1-1814s1c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-1350s1c1
Sequence:CCGGCTGGATACTCTTAGCATCTATCTCGAGATAGATGCTAAGAGTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-1536s1c1
Sequence:CCGGCGAGTGAGGAATTTGTTCAATCTCGAGATTGAACAAATTCCTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-879s1c1
Sequence:CCGGCCTTTCAAAGACCTGGGCAATCTCGAGATTGCCCAGGTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-565s21c1
Sequence:CCGGACGGGATTGACTCGGTGATTGCTCGAGCAATCACCGAGTCAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2282s21c1
Sequence:CCGGGATGGAGGACTTCCGGCAATACTCGAGTATTGCCGGAAGTCCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2197s21c1
Sequence:CCGGAGAAGTACTCCAAGATCTTTGCTCGAGCAAAGATCTTGGAGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-811s21c1
Sequence:CCGGTCAACCTCTTCACCGACTTTGCTCGAGCAAAGTCGGTGAAGAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2534s21c1
Sequence:CCGGGCTGGGCTCTTACCTGTGCTTCTCGAGAAGCACAGGTAAGAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133916
VALIDATED
EIF3B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133916.1-2534s1c1
Sequence:CCGGGCTGGGCTCTTACCTGTGCTTCTCGAGAAGCACAGGTAAGAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133916.1-1814s1c1
Sequence:CCGGCGGGAAGATTGAACTCATCAACTCGAGTTGATGAGTTCAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-1350s1c1
Sequence:CCGGCTGGATACTCTTAGCATCTATCTCGAGATAGATGCTAAGAGTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-1536s1c1
Sequence:CCGGCGAGTGAGGAATTTGTTCAATCTCGAGATTGAACAAATTCCTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133916.1-879s1c1
Sequence:CCGGCCTTTCAAAGACCTGGGCAATCTCGAGATTGCCCAGGTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-565s21c1
Sequence:CCGGACGGGATTGACTCGGTGATTGCTCGAGCAATCACCGAGTCAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2282s21c1
Sequence:CCGGGATGGAGGACTTCCGGCAATACTCGAGTATTGCCGGAAGTCCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2197s21c1
Sequence:CCGGAGAAGTACTCCAAGATCTTTGCTCGAGCAAAGATCTTGGAGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-811s21c1
Sequence:CCGGTCAACCTCTTCACCGACTTTGCTCGAGCAAAGTCGGTGAAGAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133916.2-2534s21c1
Sequence:CCGGGCTGGGCTCTTACCTGTGCTTCTCGAGAAGCACAGGTAAGAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks