EMAIL THIS PAGE TO A FRIEND

EIF3C

eukaryotic translation initiation factor 3, subunit C

72 Gene Product Result for
Synonyms: EIF3CL EIF3S8 eIF3-p110
UniProtKB ID: Q99613, A8K7Z0, B2RXG3, O00215, Q9BW98
Gene ID:
Mouse(56347) eukaryotic translation initiation factor 3, subunit C
Rat(293484) eukaryotic translation initiation factor 3, subunit C
Zebrafish(334234) eukaryotic translation initiation factor 3, subunit C
Horse(100064310) eukaryotic translation initiation factor 3, subunit C
dog(479795) eukaryotic translation initiation factor 3, subunit C
Thale Cress(824781) eukaryotic translation initiation factor 3 subunit C
chicken(776316) eukaryotic translation initiation factor 3, subunit C
domestic guinea pig(100727341) eukaryotic translation initiation factor 3, subunit C
naked mole-rat(101722119) eukaryotic translation initiation factor 3, subunit C
Domestic Rabbit(100344472) eukaryotic translation initiation factor 3, subunit C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003752 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037808 Rosetta Predictions human pricing
NM_003752 Rosetta Predictions human pricing
NM_001100662 Rosetta Predictions rat pricing
NM_146200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076129 predicted 582
2 SASI_Hs01_00076130 predicted 1107
3 SASI_Hs01_00076131 predicted 1111
4 SASI_Hs01_00076132 predicted 2020
5 SASI_Hs01_00076134 predicted 1474
6 SASI_Hs02_00308374 predicted 1761
7 SASI_Hs01_00076136 predicted 583
8 SASI_Hs01_00076137 predicted 576
9 SASI_Hs02_00308375 predicted 1784
10 SASI_Hs01_00076138 predicted 315
11 SASI_Hs01_00076133 predicted 1126
12 SASI_Hs01_00076135 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046588 predicted 530
2 SASI_Hs01_00046589 predicted 1059
3 SASI_Hs01_00046590 predicted 1065
4 SASI_Hs01_00046591 predicted 1964
5 SASI_Hs01_00046593 predicted 1426
6 SASI_Hs02_00336218 predicted 1717
7 SASI_Hs01_00046595 predicted 526
8 SASI_Hs01_00046596 predicted 531
9 SASI_Hs02_00336219 predicted 1737
10 SASI_Hs01_00046597 predicted 272
11 SASI_Hs01_00046592 predicted 1076
12 SASI_Hs01_00046594 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210228 predicted 2090
2 SASI_Rn02_00210229 predicted 1399
3 SASI_Rn02_00210230 predicted 1722
4 SASI_Rn02_00210231 predicted 1482
5 SASI_Rn02_00210232 predicted 1042
6 SASI_Rn02_00210233 predicted 514
7 SASI_Rn02_00210234 predicted 1407
8 SASI_Rn02_00210235 predicted 2580
9 SASI_Rn02_00210236 predicted 1597
10 SASI_Rn02_00210237 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030460 predicted 2063
2 SASI_Mm01_00030461 predicted 2020
3 SASI_Mm01_00030462 predicted 1239
4 SASI_Mm01_00030463 predicted 2515
5 SASI_Mm01_00030464 predicted 504
6 SASI_Mm01_00030465 predicted 479
7 SASI_Mm01_00030466 predicted 244
8 SASI_Mm01_00030467 predicted 631
9 SASI_Mm01_00030468 predicted 1546
10 SASI_Mm02_00341892 predicted 1329
11 SASI_Mm01_00030459 predicted 1942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146200
VALIDATED
EIF3C MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-1583s21c1
Sequence:CCGGGTACTACAAGTTTGACTACAACTCGAGTTGTAGTCAAACTTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-245s21c1
Sequence:CCGGCCTCATACGAACCATCCGTAACTCGAGTTACGGATGGTTCGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-481s21c1
Sequence:CCGGTGCGCCAGAAGATCCGGAAATCTCGAGATTTCCGGATCTTCTGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-619s21c1
Sequence:CCGGACGAGGACGGAGTCGGTAATACTCGAGTATTACCGACTCCGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146200.1-367s21c1
Sequence:CCGGCCCGATTCTACATCCGAATACCTCGAGGTATTCGGATGTAGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1925s1c1
Sequence:CCGGCCTGACAAAGGATGCACACAACTCGAGTTGTGTGCATCCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1264s1c1
Sequence:CCGGGCATCAATGAACTGATGGATACTCGAGTATCCATCAGTTCATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-245s1c1
Sequence:CCGGCCTCATACGAACCATCCGTAACTCGAGTTACGGATGGTTCGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-162s1c1
Sequence:CCGGCCTTTGTTACTGAGCGAGGATCTCGAGATCCTCGCTCAGTAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1583s1c1
Sequence:CCGGGTACTACAAGTTTGACTACAACTCGAGTTGTAGTCAAACTTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146200
VALIDATED
EIF3C MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-1583s21c1
Sequence:CCGGGTACTACAAGTTTGACTACAACTCGAGTTGTAGTCAAACTTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-245s21c1
Sequence:CCGGCCTCATACGAACCATCCGTAACTCGAGTTACGGATGGTTCGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-481s21c1
Sequence:CCGGTGCGCCAGAAGATCCGGAAATCTCGAGATTTCCGGATCTTCTGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-619s21c1
Sequence:CCGGACGAGGACGGAGTCGGTAATACTCGAGTATTACCGACTCCGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146200.1-367s21c1
Sequence:CCGGCCCGATTCTACATCCGAATACCTCGAGGTATTCGGATGTAGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1925s1c1
Sequence:CCGGCCTGACAAAGGATGCACACAACTCGAGTTGTGTGCATCCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1264s1c1
Sequence:CCGGGCATCAATGAACTGATGGATACTCGAGTATCCATCAGTTCATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-245s1c1
Sequence:CCGGCCTCATACGAACCATCCGTAACTCGAGTTACGGATGGTTCGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-162s1c1
Sequence:CCGGCCTTTGTTACTGAGCGAGGATCTCGAGATCCTCGCTCAGTAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1583s1c1
Sequence:CCGGGTACTACAAGTTTGACTACAACTCGAGTTGTAGTCAAACTTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146200
VALIDATED
EIF3C MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-1583s21c1
Sequence:CCGGGTACTACAAGTTTGACTACAACTCGAGTTGTAGTCAAACTTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-245s21c1
Sequence:CCGGCCTCATACGAACCATCCGTAACTCGAGTTACGGATGGTTCGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-481s21c1
Sequence:CCGGTGCGCCAGAAGATCCGGAAATCTCGAGATTTCCGGATCTTCTGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146200.1-619s21c1
Sequence:CCGGACGAGGACGGAGTCGGTAATACTCGAGTATTACCGACTCCGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146200.1-367s21c1
Sequence:CCGGCCCGATTCTACATCCGAATACCTCGAGGTATTCGGATGTAGAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1925s1c1
Sequence:CCGGCCTGACAAAGGATGCACACAACTCGAGTTGTGTGCATCCTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1264s1c1
Sequence:CCGGGCATCAATGAACTGATGGATACTCGAGTATCCATCAGTTCATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-245s1c1
Sequence:CCGGCCTCATACGAACCATCCGTAACTCGAGTTACGGATGGTTCGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-162s1c1
Sequence:CCGGCCTTTGTTACTGAGCGAGGATCTCGAGATCCTCGCTCAGTAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146200.1-1583s1c1
Sequence:CCGGGTACTACAAGTTTGACTACAACTCGAGTTGTAGTCAAACTTGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003752
EIF3C MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-1610s1c1
Sequence:CCGGCACACCTACTACAAGTTTGATCTCGAGATCAAACTTGTAGTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-838s1c1
Sequence:CCGGGCTGGCCTCAAGATTTCTTAACTCGAGTTAAGAAATCTTGAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-419s1c1
Sequence:CCGGGACCTAGAGGACTATCTTAATCTCGAGATTAAGATAGTCCTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003752.2-2855s1c1
Sequence:CCGGCATCCAACCTTGAAGTCCTAACTCGAGTTAGGACTTCAAGGTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-1318s1c1
Sequence:CCGGCCTGTTTGCAAATCCCAACATCTCGAGATGTTGGGATTTGCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003752
EIF3C MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-1610s1c1
Sequence:CCGGCACACCTACTACAAGTTTGATCTCGAGATCAAACTTGTAGTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-838s1c1
Sequence:CCGGGCTGGCCTCAAGATTTCTTAACTCGAGTTAAGAAATCTTGAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-419s1c1
Sequence:CCGGGACCTAGAGGACTATCTTAATCTCGAGATTAAGATAGTCCTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003752.2-2855s1c1
Sequence:CCGGCATCCAACCTTGAAGTCCTAACTCGAGTTAGGACTTCAAGGTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-1318s1c1
Sequence:CCGGCCTGTTTGCAAATCCCAACATCTCGAGATGTTGGGATTTGCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003752
EIF3C MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-1610s1c1
Sequence:CCGGCACACCTACTACAAGTTTGATCTCGAGATCAAACTTGTAGTAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-838s1c1
Sequence:CCGGGCTGGCCTCAAGATTTCTTAACTCGAGTTAAGAAATCTTGAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-419s1c1
Sequence:CCGGGACCTAGAGGACTATCTTAATCTCGAGATTAAGATAGTCCTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003752.2-2855s1c1
Sequence:CCGGCATCCAACCTTGAAGTCCTAACTCGAGTTAGGACTTCAAGGTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003752.2-1318s1c1
Sequence:CCGGCCTGTTTGCAAATCCCAACATCTCGAGATGTTGGGATTTGCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks