EMAIL THIS PAGE TO A FRIEND

EIF3CL

eukaryotic translation initiation factor 3, subunit C-like

12 Gene Product Result for
UniProtKB ID: B5ME19
Gene ID:
cow(534882) eukaryotic translation initiation factor 3, subunit C-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320916 predicted 530
2 SASI_Hs02_00320917 predicted 1062
3 SASI_Hs02_00320918 predicted 1070
4 SASI_Hs02_00320919 predicted 1969
5 SASI_Hs02_00320920 predicted 1434
6 SASI_Hs02_00320921 predicted 252
7 SASI_Hs02_00320922 predicted 1724
8 SASI_Hs02_00320923 predicted 528
9 SASI_Hs02_00320924 predicted 536
10 SASI_Hs02_00320925 predicted 1745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099661
EIF3CL MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit C-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-422s21c1
Sequence:CCGGTGACCTAGAGGACTATCTTAACTCGAGTTAAGATAGTCCTCTAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-657s21c1
Sequence:CCGGGGAGTCAGTGCTGCAACTTTCCTCGAGGAAAGTTGCAGCACTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-276s21c1
Sequence:CCGGCTTATCCGGACCATCCGTAATCTCGAGATTACGGATGGTCCGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099661.1-2863s21c1
Sequence:CCGGATCCAACCTTGAAGTCCTAAACTCGAGTTTAGGACTTCAAGGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-1867s21c1
Sequence:CCGGGCCACTTGCAGGACAACATTCCTCGAGGAATGTTGTCCTGCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099661
EIF3CL MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit C-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-422s21c1
Sequence:CCGGTGACCTAGAGGACTATCTTAACTCGAGTTAAGATAGTCCTCTAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-657s21c1
Sequence:CCGGGGAGTCAGTGCTGCAACTTTCCTCGAGGAAAGTTGCAGCACTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-276s21c1
Sequence:CCGGCTTATCCGGACCATCCGTAATCTCGAGATTACGGATGGTCCGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099661.1-2863s21c1
Sequence:CCGGATCCAACCTTGAAGTCCTAAACTCGAGTTTAGGACTTCAAGGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-1867s21c1
Sequence:CCGGGCCACTTGCAGGACAACATTCCTCGAGGAATGTTGTCCTGCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099661
EIF3CL MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit C-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-422s21c1
Sequence:CCGGTGACCTAGAGGACTATCTTAACTCGAGTTAAGATAGTCCTCTAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-657s21c1
Sequence:CCGGGGAGTCAGTGCTGCAACTTTCCTCGAGGAAAGTTGCAGCACTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-276s21c1
Sequence:CCGGCTTATCCGGACCATCCGTAATCTCGAGATTACGGATGGTCCGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099661.1-2863s21c1
Sequence:CCGGATCCAACCTTGAAGTCCTAAACTCGAGTTTAGGACTTCAAGGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099661.1-1867s21c1
Sequence:CCGGGCCACTTGCAGGACAACATTCCTCGAGGAATGTTGTCCTGCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks