EMAIL THIS PAGE TO A FRIEND

EIF3D

eukaryotic translation initiation factor 3, subunit D

63 Gene Product Result for
Synonyms: EIF3S7 eIF3-p66 eIF3-zeta
UniProtKB ID: O15371, B2R7D4, Q3MJD9, Q5M9Q6
Gene ID:
Human(8664) Summary: Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Mouse(55944) eukaryotic translation initiation factor 3, subunit D
Rat(362952) eukaryotic translation initiation factor 3, subunit D
Zebrafish(336498) eukaryotic translation initiation factor 3, subunit D
dog(608665) eukaryotic translation initiation factor 3, subunit D
domestic cat(101094273) eukaryotic translation initiation factor 3, subunit D
cow(515226) eukaryotic translation initiation factor 3, subunit D
chicken(771356) eukaryotic translation initiation factor 3, subunit D
sheep(101122181) eukaryotic translation initiation factor 3, subunit D
Domestic Rabbit(100344219) eukaryotic translation initiation factor 3, subunit D
naked mole-rat(101701350) eukaryotic translation initiation factor 3, subunit D
domestic guinea pig(100728709) eukaryotic translation initiation factor 3, subunit D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003753 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003753 Rosetta Predictions human pricing
NM_001004283 Rosetta Predictions rat pricing
NM_018749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177171 predicted 1387
2 SASI_Hs02_00336220 predicted 524
3 SASI_Hs01_00177172 predicted 753
4 SASI_Hs02_00336221 predicted 639
5 SASI_Hs01_00177174 predicted 301
6 SASI_Hs01_00177175 predicted 1316
7 SASI_Hs01_00177176 predicted 982
8 SASI_Hs02_00336222 predicted 718
9 SASI_Hs01_00177177 predicted 925
10 SASI_Hs01_00177178 predicted 1110
11 SASI_Hs01_00177173 predicted 658
12 SASI_Hs01_00177179 predicted 1217
13 SASI_Hs01_00177180 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046974 predicted 474
2 SASI_Rn01_00046975 predicted 416
3 SASI_Rn01_00046976 predicted 1315
4 SASI_Rn01_00046979 predicted 1048
5 SASI_Rn01_00046980 predicted 1438
6 SASI_Rn01_00046981 predicted 402
7 SASI_Rn01_00046982 predicted 1416
8 SASI_Rn01_00046983 predicted 260
9 SASI_Rn02_00198329 predicted 900
10 SASI_Rn02_00198330 predicted 235
11 SASI_Rn01_00046977 predicted 1201
12 SASI_Rn01_00046978 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324019 predicted 572
2 SASI_Mm01_00175866 predicted 1380
3 SASI_Mm02_00324020 predicted 633
4 SASI_Mm02_00324021 predicted 482
5 SASI_Mm02_00324022 predicted 807
6 SASI_Mm02_00324023 predicted 227
7 SASI_Mm02_00324024 predicted 1241
8 SASI_Mm02_00324025 predicted 1110
9 SASI_Mm01_00175868 predicted 1028
10 SASI_Mm02_00324026 predicted 540
11 SASI_Mm01_00175867 predicted 237
12 SASI_Mm01_00175869 predicted 269
13 SASI_Mm01_00175870 predicted 294
14 SASI_Mm01_00175871 predicted 248
15 SASI_Mm01_00175872 predicted 326
16 SASI_Mm01_00175873 predicted 258
17 SASI_Mm01_00175874 predicted 980
18 SASI_Mm01_00175875 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018749
VALIDATED
EIF3D MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-686s21c1
Sequence:CCGGGCTGATGAAGATGCGCTACTTCTCGAGAAGTAGCGCATCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-750s21c1
Sequence:CCGGGAGTACTACGACAAAGCCTTTCTCGAGAAAGGCTTTGTCGTAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-805s21c1
Sequence:CCGGGGAGCATCAAGCGCATCTTTCCTCGAGGAAAGATGCGCTTGATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-311s21c1
Sequence:CCGGGAGGTACACAAACAAGTATTCCTCGAGGAATACTTGTTTGTGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-957s21c1
Sequence:CCGGGTCCAGAGAGTCGGCTCTAAACTCGAGTTTAGAGCCGACTCTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018749.1-1500s1c1
Sequence:CCGGGCAGTTTAAGCCCAATGAGTTCTCGAGAACTCATTGGGCTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018749.1-693s1c1
Sequence:CCGGGAGTACTACGACAAAGCCTTTCTCGAGAAAGGCTTTGTCGTAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018749.1-630s1c1
Sequence:CCGGGCTGATGAAGATGCGCTACTTCTCGAGAAGTAGCGCATCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018749.1-157s1c1
Sequence:CCGGGTTCCTGAGCAATTTCGGGATCTCGAGATCCCGAAATTGCTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018749
VALIDATED
EIF3D MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-686s21c1
Sequence:CCGGGCTGATGAAGATGCGCTACTTCTCGAGAAGTAGCGCATCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-750s21c1
Sequence:CCGGGAGTACTACGACAAAGCCTTTCTCGAGAAAGGCTTTGTCGTAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-805s21c1
Sequence:CCGGGGAGCATCAAGCGCATCTTTCCTCGAGGAAAGATGCGCTTGATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-311s21c1
Sequence:CCGGGAGGTACACAAACAAGTATTCCTCGAGGAATACTTGTTTGTGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-957s21c1
Sequence:CCGGGTCCAGAGAGTCGGCTCTAAACTCGAGTTTAGAGCCGACTCTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018749.1-1500s1c1
Sequence:CCGGGCAGTTTAAGCCCAATGAGTTCTCGAGAACTCATTGGGCTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018749.1-693s1c1
Sequence:CCGGGAGTACTACGACAAAGCCTTTCTCGAGAAAGGCTTTGTCGTAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018749.1-630s1c1
Sequence:CCGGGCTGATGAAGATGCGCTACTTCTCGAGAAGTAGCGCATCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018749.1-157s1c1
Sequence:CCGGGTTCCTGAGCAATTTCGGGATCTCGAGATCCCGAAATTGCTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018749
VALIDATED
EIF3D MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-686s21c1
Sequence:CCGGGCTGATGAAGATGCGCTACTTCTCGAGAAGTAGCGCATCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-750s21c1
Sequence:CCGGGAGTACTACGACAAAGCCTTTCTCGAGAAAGGCTTTGTCGTAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-805s21c1
Sequence:CCGGGGAGCATCAAGCGCATCTTTCCTCGAGGAAAGATGCGCTTGATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-311s21c1
Sequence:CCGGGAGGTACACAAACAAGTATTCCTCGAGGAATACTTGTTTGTGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018749.2-957s21c1
Sequence:CCGGGTCCAGAGAGTCGGCTCTAAACTCGAGTTTAGAGCCGACTCTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018749.1-1500s1c1
Sequence:CCGGGCAGTTTAAGCCCAATGAGTTCTCGAGAACTCATTGGGCTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018749.1-693s1c1
Sequence:CCGGGAGTACTACGACAAAGCCTTTCTCGAGAAAGGCTTTGTCGTAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018749.1-630s1c1
Sequence:CCGGGCTGATGAAGATGCGCTACTTCTCGAGAAGTAGCGCATCTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018749.1-157s1c1
Sequence:CCGGGTTCCTGAGCAATTTCGGGATCTCGAGATCCCGAAATTGCTCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003753
VALIDATED
EIF3D MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003753.2-1775s1c1
Sequence:CCGGCCAGCAGTTCAAGCCTAATGACTCGAGTCATTAGGCTTGAACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-864s1c1
Sequence:CCGGCGTAGTGATTGGGAAGTGAAACTCGAGTTTCACTTCCCAATCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003753.2-1407s1c1
Sequence:CCGGGACGACATGGATAAGAATGAACTCGAGTTCATTCTTATCCATGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-853s1c1
Sequence:CCGGCAGTTGAAGTTCGTAGTGATTCTCGAGAATCACTACGAACTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-963s1c1
Sequence:CCGGGCCCTAGAATACTACGACAAACTCGAGTTTGTCGTAGTATTCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-473s1c1
Sequence:CCGGCAAAGGAGATCGGCTAGGAAACTCGAGTTTCCTAGCCGATCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-737s1c1
Sequence:CCGGGCCTAAGAGTGCCAAACAGAACTCGAGTTCTGTTTGGCACTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-1849s1c1
Sequence:CCGGGCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-1847s1c1
Sequence:CCGGCTGCGTCATTGACATCTGCATCTCGAGATGCAGATGTCAATGACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003753
VALIDATED
EIF3D MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003753.2-1775s1c1
Sequence:CCGGCCAGCAGTTCAAGCCTAATGACTCGAGTCATTAGGCTTGAACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-864s1c1
Sequence:CCGGCGTAGTGATTGGGAAGTGAAACTCGAGTTTCACTTCCCAATCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003753.2-1407s1c1
Sequence:CCGGGACGACATGGATAAGAATGAACTCGAGTTCATTCTTATCCATGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-853s1c1
Sequence:CCGGCAGTTGAAGTTCGTAGTGATTCTCGAGAATCACTACGAACTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-963s1c1
Sequence:CCGGGCCCTAGAATACTACGACAAACTCGAGTTTGTCGTAGTATTCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-473s1c1
Sequence:CCGGCAAAGGAGATCGGCTAGGAAACTCGAGTTTCCTAGCCGATCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-737s1c1
Sequence:CCGGGCCTAAGAGTGCCAAACAGAACTCGAGTTCTGTTTGGCACTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-1849s1c1
Sequence:CCGGGCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-1847s1c1
Sequence:CCGGCTGCGTCATTGACATCTGCATCTCGAGATGCAGATGTCAATGACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003753
VALIDATED
EIF3D MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003753.2-1775s1c1
Sequence:CCGGCCAGCAGTTCAAGCCTAATGACTCGAGTCATTAGGCTTGAACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-864s1c1
Sequence:CCGGCGTAGTGATTGGGAAGTGAAACTCGAGTTTCACTTCCCAATCACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003753.2-1407s1c1
Sequence:CCGGGACGACATGGATAAGAATGAACTCGAGTTCATTCTTATCCATGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-853s1c1
Sequence:CCGGCAGTTGAAGTTCGTAGTGATTCTCGAGAATCACTACGAACTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-963s1c1
Sequence:CCGGGCCCTAGAATACTACGACAAACTCGAGTTTGTCGTAGTATTCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-473s1c1
Sequence:CCGGCAAAGGAGATCGGCTAGGAAACTCGAGTTTCCTAGCCGATCTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003753.2-737s1c1
Sequence:CCGGGCCTAAGAGTGCCAAACAGAACTCGAGTTCTGTTTGGCACTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-1849s1c1
Sequence:CCGGGCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003753.2-1847s1c1
Sequence:CCGGCTGCGTCATTGACATCTGCATCTCGAGATGCAGATGTCAATGACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks