EMAIL THIS PAGE TO A FRIEND

EIF3E

eukaryotic translation initiation factor 3, subunit E

68 Gene Product Result for
Synonyms: EIF3-P48 EIF3S6 INT6 eIF3-p46
Gene ID:
Mouse(16341) eukaryotic translation initiation factor 3, subunit E
Rat(299872) eukaryotic translation initiation factor 3, subunit E
domestic guinea pig(100735990) eukaryotic translation initiation factor 3, subunit E
naked mole-rat(101705289) eukaryotic translation initiation factor 3, subunit E
sheep(101118881) eukaryotic translation initiation factor 3, subunit E
Domestic Rabbit(100346441) eukaryotic translation initiation factor 3, subunit E
Thale Cress(824896) eukaryotic translation initiation factor 3E
domestic cat(101087902) eukaryotic translation initiation factor 3, subunit E
cow(534165) eukaryotic translation initiation factor 3, subunit E
Horse(100063841) eukaryotic translation initiation factor 3, subunit E
dog(475070) eukaryotic translation initiation factor 3, subunit E
chicken(420272) eukaryotic translation initiation factor 3, subunit E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100662 Anti-EIF3E (ab1) antibody produced in rabbit affinity isolated antibody bovine, canine, zebrafish, mouse, horse, guinea pig, rabbit, human, rat
western blot pricing
SAB2100663 Anti-EIF3E (ab2) antibody produced in rabbit affinity isolated antibody zebrafish, rat, rabbit, bovine, mouse, human, horse, canine, guinea pig
western blot pricing
SAB2501569 Anti-EIF3E (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, bovine, canine, bovine
ELISA, western blot pricing
HPA023973 Anti-EIF3E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001568 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001568 Rosetta Predictions human pricing
NM_001011990 Rosetta Predictions rat pricing
XM_576262 Rosetta Predictions rat pricing
NM_008388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166667 predicted 502
2 SASI_Hs01_00166672 predicted 919
3 SASI_Hs01_00166676 predicted 905
4 SASI_Hs01_00166671 predicted 505
5 SASI_Hs01_00166668 predicted 665
6 SASI_Hs01_00166669 predicted 894
7 SASI_Hs01_00166674 predicted 968
8 SASI_Hs01_00166675 predicted 1069
9 SASI_Hs02_00332139 predicted 810
10 SASI_Hs02_00332140 predicted 287
11 SASI_Hs01_00166670 predicted 626
12 SASI_Hs01_00166673 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084955 predicted 481
2 SASI_Rn02_00200022 predicted 274
3 SASI_Rn01_00084956 predicted 1240
4 SASI_Rn01_00084957 predicted 558
5 SASI_Rn01_00084958 predicted 265
6 SASI_Rn01_00084959 predicted 366
7 SASI_Rn01_00084960 predicted 591
8 SASI_Rn01_00084961 predicted 816
9 SASI_Rn01_00084962 predicted 414
10 SASI_Rn01_00084963 predicted 601
11 SASI_Rn01_00084964 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133937 predicted 520
2 SASI_Rn01_00133938 predicted 1284
3 SASI_Rn01_00133939 predicted 597
4 SASI_Rn01_00133940 predicted 308
5 SASI_Rn01_00133941 predicted 404
6 SASI_Rn01_00133942 predicted 632
7 SASI_Rn01_00133943 predicted 867
8 SASI_Rn01_00133944 predicted 456
9 SASI_Rn01_00133945 predicted 640
10 SASI_Rn01_00133946 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165151 predicted 477
2 SASI_Mm02_00313771 predicted 453
3 SASI_Mm01_00165155 predicted 426
4 SASI_Mm02_00313772 predicted 307
5 SASI_Mm02_00313773 predicted 817
6 SASI_Mm01_00165157 predicted 597
7 SASI_Mm02_00313774 predicted 682
8 SASI_Mm02_00313775 predicted 305
9 SASI_Mm01_00165159 predicted 408
10 SASI_Mm01_00165160 predicted 527
11 SASI_Mm01_00165152 predicted 1253
12 SASI_Mm01_00165153 predicted 954
13 SASI_Mm01_00165154 predicted 270
14 SASI_Mm01_00165156 predicted 596
15 SASI_Mm01_00165158 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008388
VALIDATED
EIF3E MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit E
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-1149s1c1
Sequence:CCGGGCCAAGATTGATTCTAAACTACTCGAGTAGTTTAGAATCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-723s1c1
Sequence:CCGGCCACAGTATCTTAATGCAATTCTCGAGAATTGCATTAAGATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-257s1c1
Sequence:CCGGCCAGGCAGAAACAGAACCAATCTCGAGATTGGTTCTGTTTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008388.1-447s1c1
Sequence:CCGGGCAGAGTATCTTTACTTCTTTCTCGAGAAAGAAGTAAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-831s1c1
Sequence:CCGGGATCTGGTGAAAGTGATTCAACTCGAGTTGAATCACTTTCACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-870s21c1
Sequence:CCGGGATCTGGTGAAAGTGATTCAACTCGAGTTGAATCACTTTCACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-1188s21c1
Sequence:CCGGGCCAAGATTGATTCTAAACTACTCGAGTAGTTTAGAATCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-486s21c1
Sequence:CCGGGCAGAGTATCTTTACTTCTTTCTCGAGAAAGAAGTAAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-296s21c1
Sequence:CCGGCCAGGCAGAAACAGAACCAATCTCGAGATTGGTTCTGTTTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-762s21c1
Sequence:CCGGCCACAGTATCTTAATGCAATTCTCGAGAATTGCATTAAGATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008388
VALIDATED
EIF3E MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit E
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-1149s1c1
Sequence:CCGGGCCAAGATTGATTCTAAACTACTCGAGTAGTTTAGAATCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-723s1c1
Sequence:CCGGCCACAGTATCTTAATGCAATTCTCGAGAATTGCATTAAGATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-257s1c1
Sequence:CCGGCCAGGCAGAAACAGAACCAATCTCGAGATTGGTTCTGTTTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008388.1-447s1c1
Sequence:CCGGGCAGAGTATCTTTACTTCTTTCTCGAGAAAGAAGTAAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-831s1c1
Sequence:CCGGGATCTGGTGAAAGTGATTCAACTCGAGTTGAATCACTTTCACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-870s21c1
Sequence:CCGGGATCTGGTGAAAGTGATTCAACTCGAGTTGAATCACTTTCACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-1188s21c1
Sequence:CCGGGCCAAGATTGATTCTAAACTACTCGAGTAGTTTAGAATCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-486s21c1
Sequence:CCGGGCAGAGTATCTTTACTTCTTTCTCGAGAAAGAAGTAAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-296s21c1
Sequence:CCGGCCAGGCAGAAACAGAACCAATCTCGAGATTGGTTCTGTTTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-762s21c1
Sequence:CCGGCCACAGTATCTTAATGCAATTCTCGAGAATTGCATTAAGATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008388
VALIDATED
EIF3E MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit E
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-1149s1c1
Sequence:CCGGGCCAAGATTGATTCTAAACTACTCGAGTAGTTTAGAATCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-723s1c1
Sequence:CCGGCCACAGTATCTTAATGCAATTCTCGAGAATTGCATTAAGATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-257s1c1
Sequence:CCGGCCAGGCAGAAACAGAACCAATCTCGAGATTGGTTCTGTTTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008388.1-447s1c1
Sequence:CCGGGCAGAGTATCTTTACTTCTTTCTCGAGAAAGAAGTAAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008388.1-831s1c1
Sequence:CCGGGATCTGGTGAAAGTGATTCAACTCGAGTTGAATCACTTTCACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-870s21c1
Sequence:CCGGGATCTGGTGAAAGTGATTCAACTCGAGTTGAATCACTTTCACCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-1188s21c1
Sequence:CCGGGCCAAGATTGATTCTAAACTACTCGAGTAGTTTAGAATCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-486s21c1
Sequence:CCGGGCAGAGTATCTTTACTTCTTTCTCGAGAAAGAAGTAAAGATACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-296s21c1
Sequence:CCGGCCAGGCAGAAACAGAACCAATCTCGAGATTGGTTCTGTTTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008388.2-762s21c1
Sequence:CCGGCCACAGTATCTTAATGCAATTCTCGAGAATTGCATTAAGATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001568
VALIDATED
EIF3E MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001568.1-739s1c1
Sequence:CCGGGCCACAATATCTTAATGCAATCTCGAGATTGCATTAAGATATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001568.1-1063s1c1
Sequence:CCGGCCACCAGTGTATCAGCATTAACTCGAGTTAATGCTGATACACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-1220s1c1
Sequence:CCGGCCCTATCAGCAAGTGATTGAACTCGAGTTCAATCACTTGCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-433s1c1
Sequence:CCGGCCAGTACGAATGTGGGAATTACTCGAGTAATTCCCACATTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-161s1c1
Sequence:CCGGGATACCAACATGGTAGACTTTCTCGAGAAAGTCTACCATGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-745s21c1
Sequence:CCGGGCCACAATATCTTAATGCAATCTCGAGATTGCATTAAGATATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-167s21c1
Sequence:CCGGGATACCAACATGGTAGACTTTCTCGAGAAAGTCTACCATGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-1226s21c1
Sequence:CCGGCCCTATCAGCAAGTGATTGAACTCGAGTTCAATCACTTGCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-439s21c1
Sequence:CCGGCCAGTACGAATGTGGGAATTACTCGAGTAATTCCCACATTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001568
VALIDATED
EIF3E MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001568.1-739s1c1
Sequence:CCGGGCCACAATATCTTAATGCAATCTCGAGATTGCATTAAGATATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001568.1-1063s1c1
Sequence:CCGGCCACCAGTGTATCAGCATTAACTCGAGTTAATGCTGATACACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-1220s1c1
Sequence:CCGGCCCTATCAGCAAGTGATTGAACTCGAGTTCAATCACTTGCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-433s1c1
Sequence:CCGGCCAGTACGAATGTGGGAATTACTCGAGTAATTCCCACATTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-161s1c1
Sequence:CCGGGATACCAACATGGTAGACTTTCTCGAGAAAGTCTACCATGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-745s21c1
Sequence:CCGGGCCACAATATCTTAATGCAATCTCGAGATTGCATTAAGATATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-167s21c1
Sequence:CCGGGATACCAACATGGTAGACTTTCTCGAGAAAGTCTACCATGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-1226s21c1
Sequence:CCGGCCCTATCAGCAAGTGATTGAACTCGAGTTCAATCACTTGCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-439s21c1
Sequence:CCGGCCAGTACGAATGTGGGAATTACTCGAGTAATTCCCACATTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001568
VALIDATED
EIF3E MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001568.1-739s1c1
Sequence:CCGGGCCACAATATCTTAATGCAATCTCGAGATTGCATTAAGATATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001568.1-1063s1c1
Sequence:CCGGCCACCAGTGTATCAGCATTAACTCGAGTTAATGCTGATACACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-1220s1c1
Sequence:CCGGCCCTATCAGCAAGTGATTGAACTCGAGTTCAATCACTTGCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-433s1c1
Sequence:CCGGCCAGTACGAATGTGGGAATTACTCGAGTAATTCCCACATTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001568.1-161s1c1
Sequence:CCGGGATACCAACATGGTAGACTTTCTCGAGAAAGTCTACCATGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-745s21c1
Sequence:CCGGGCCACAATATCTTAATGCAATCTCGAGATTGCATTAAGATATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-167s21c1
Sequence:CCGGGATACCAACATGGTAGACTTTCTCGAGAAAGTCTACCATGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-1226s21c1
Sequence:CCGGCCCTATCAGCAAGTGATTGAACTCGAGTTCAATCACTTGCTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001568.2-439s21c1
Sequence:CCGGCCAGTACGAATGTGGGAATTACTCGAGTAATTCCCACATTCGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks