EMAIL THIS PAGE TO A FRIEND

EIF3F

eukaryotic translation initiation factor 3, subunit F

63 Gene Product Result for
Synonyms: EIF3S5 eIF3-p47
UniProtKB ID: O00303, A8K0S2, Q6IB45, Q8N978
Gene ID:
Mouse(66085) eukaryotic translation initiation factor 3, subunit F
Rat(293427) eukaryotic translation initiation factor 3, subunit F
Zebrafish(557270) eukaryotic translation initiation factor 3, subunit F
chicken(423748) eukaryotic translation initiation factor 3, subunit F
cow(513793) eukaryotic translation initiation factor 3, subunit F
domestic cat(101083449) eukaryotic translation initiation factor 3, subunit F
dog(476840) eukaryotic translation initiation factor 3, subunit F
sheep(101108947) eukaryotic translation initiation factor 3, subunit F
naked mole-rat(101719845) eukaryotic translation initiation factor 3, subunit F
domestic guinea pig(100733279) eukaryotic translation initiation factor 3, subunit F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003754 Rosetta Predictions human pricing
NM_001106292 Rosetta Predictions rat pricing
NM_025344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246686 predicted 903
2 SASI_Hs02_00336223 predicted 985
3 SASI_Hs02_00336224 predicted 916
4 SASI_Hs02_00336225 predicted 961
5 SASI_Hs02_00336226 predicted 910
6 SASI_Hs02_00336227 predicted 889
7 SASI_Hs02_00336228 predicted 987
8 SASI_Hs02_00336229 predicted 555
9 SASI_Hs01_00246688 predicted 452
10 SASI_Hs02_00336230 predicted 773
11 SASI_Hs01_00246687 predicted 722
12 SASI_Hs01_00246689 predicted 543
13 SASI_Hs01_00246690 predicted 664
14 SASI_Hs01_00246691 predicted 453
15 SASI_Hs01_00246692 predicted 869
16 SASI_Hs01_00246693 predicted 1208
17 SASI_Hs01_00246694 predicted 1209
18 SASI_Hs01_00246695 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217538 predicted 486
2 SASI_Rn02_00217539 predicted 817
3 SASI_Rn02_00217540 predicted 727
4 SASI_Rn02_00217541 predicted 921
5 SASI_Rn02_00217542 predicted 831
6 SASI_Rn02_00217543 predicted 972
7 SASI_Rn02_00217544 predicted 488
8 SASI_Rn02_00217545 predicted 729
9 SASI_Rn02_00217546 predicted 931
10 SASI_Rn02_00217547 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144354 predicted 872
2 SASI_Mm02_00328004 predicted 764
3 SASI_Mm01_00144355 predicted 957
4 SASI_Mm01_00144356 predicted 729
5 SASI_Mm01_00144357 predicted 742
6 SASI_Mm01_00144359 predicted 867
7 SASI_Mm01_00144360 predicted 367
8 SASI_Mm01_00144361 predicted 991
9 SASI_Mm01_00144362 predicted 879
10 SASI_Mm01_00144363 predicted 536
11 SASI_Mm01_00144358 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003754
VALIDATED
EIF3F MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit F
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-660s21c1
Sequence:CCGGCCGCATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-448s21c1
Sequence:CCGGCACAATGAGTCAGAAGATGAACTCGAGTTCATCTTCTGACTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-753s21c1
Sequence:CCGGGTACTACGACACTGAACGCATCTCGAGATGCGTTCAGTGTCGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-826s21c1
Sequence:CCGGCTCTCAAGTGACTTGCAGCAACTCGAGTTGCTGCAAGTCACTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003754.2-1066s21c1
Sequence:CCGGCAGTCACAGATTGCACTCAATCTCGAGATTGAGTGCAATCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-421s1c1
Sequence:CCGGCACAATGAGTCAGAAGATGAACTCGAGTTCATCTTCTGACTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-799s1c1
Sequence:CCGGCTCTCAAGTGACTTGCAGCAACTCGAGTTGCTGCAAGTCACTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-1039s1c1
Sequence:CCGGCAGTCACAGATTGCACTCAATCTCGAGATTGAGTGCAATCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-726s1c1
Sequence:CCGGGTACTACGACACTGAACGCATCTCGAGATGCGTTCAGTGTCGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-633s1c1
Sequence:CCGGCCGCATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003754
VALIDATED
EIF3F MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit F
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-660s21c1
Sequence:CCGGCCGCATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-448s21c1
Sequence:CCGGCACAATGAGTCAGAAGATGAACTCGAGTTCATCTTCTGACTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-753s21c1
Sequence:CCGGGTACTACGACACTGAACGCATCTCGAGATGCGTTCAGTGTCGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-826s21c1
Sequence:CCGGCTCTCAAGTGACTTGCAGCAACTCGAGTTGCTGCAAGTCACTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003754.2-1066s21c1
Sequence:CCGGCAGTCACAGATTGCACTCAATCTCGAGATTGAGTGCAATCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-421s1c1
Sequence:CCGGCACAATGAGTCAGAAGATGAACTCGAGTTCATCTTCTGACTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-799s1c1
Sequence:CCGGCTCTCAAGTGACTTGCAGCAACTCGAGTTGCTGCAAGTCACTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-1039s1c1
Sequence:CCGGCAGTCACAGATTGCACTCAATCTCGAGATTGAGTGCAATCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-726s1c1
Sequence:CCGGGTACTACGACACTGAACGCATCTCGAGATGCGTTCAGTGTCGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-633s1c1
Sequence:CCGGCCGCATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003754
VALIDATED
EIF3F MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit F
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-660s21c1
Sequence:CCGGCCGCATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-448s21c1
Sequence:CCGGCACAATGAGTCAGAAGATGAACTCGAGTTCATCTTCTGACTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-753s21c1
Sequence:CCGGGTACTACGACACTGAACGCATCTCGAGATGCGTTCAGTGTCGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003754.2-826s21c1
Sequence:CCGGCTCTCAAGTGACTTGCAGCAACTCGAGTTGCTGCAAGTCACTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003754.2-1066s21c1
Sequence:CCGGCAGTCACAGATTGCACTCAATCTCGAGATTGAGTGCAATCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-421s1c1
Sequence:CCGGCACAATGAGTCAGAAGATGAACTCGAGTTCATCTTCTGACTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-799s1c1
Sequence:CCGGCTCTCAAGTGACTTGCAGCAACTCGAGTTGCTGCAAGTCACTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-1039s1c1
Sequence:CCGGCAGTCACAGATTGCACTCAATCTCGAGATTGAGTGCAATCTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-726s1c1
Sequence:CCGGGTACTACGACACTGAACGCATCTCGAGATGCGTTCAGTGTCGTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003754.1-633s1c1
Sequence:CCGGCCGCATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025344
VALIDATED
EIF3F MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit F
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-659s21c1
Sequence:CCGGATGAGCATCAAGGCCTATGTCCTCGAGGACATAGGCCTTGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-1068s21c1
Sequence:CCGGAGATTGCCCTCAACGAGAAACCTCGAGGTTTCTCGTTGAGGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-734s21c1
Sequence:CCGGACAGTGAAGTACGCGTATTATCTCGAGATAATACGCGTACTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-578s21c1
Sequence:CCGGGTGCTGATCCATGAGTACTACCTCGAGGTAGTACTCATGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-859s21c1
Sequence:CCGGTCGCATCCAGGATGCTCTAAGCTCGAGCTTAGAGCATCCTGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-385s1c1
Sequence:CCGGCCTGTTGGGAACTGTTGACAACTCGAGTTGTCAACAGTTCCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-778s1c1
Sequence:CCGGCCTCATCATGAAGACGTGTTTCTCGAGAAACACGTCTTCATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-464s1c1
Sequence:CCGGGTGGCTGTTGACATGGAATTTCTCGAGAAATTCCATGTCAACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-962s1c1
Sequence:CCGGGTCAACCAAGTACCCAAGATACTCGAGTATCTTGGGTACTTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025344
VALIDATED
EIF3F MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit F
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-659s21c1
Sequence:CCGGATGAGCATCAAGGCCTATGTCCTCGAGGACATAGGCCTTGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-1068s21c1
Sequence:CCGGAGATTGCCCTCAACGAGAAACCTCGAGGTTTCTCGTTGAGGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-734s21c1
Sequence:CCGGACAGTGAAGTACGCGTATTATCTCGAGATAATACGCGTACTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-578s21c1
Sequence:CCGGGTGCTGATCCATGAGTACTACCTCGAGGTAGTACTCATGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-859s21c1
Sequence:CCGGTCGCATCCAGGATGCTCTAAGCTCGAGCTTAGAGCATCCTGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-385s1c1
Sequence:CCGGCCTGTTGGGAACTGTTGACAACTCGAGTTGTCAACAGTTCCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-778s1c1
Sequence:CCGGCCTCATCATGAAGACGTGTTTCTCGAGAAACACGTCTTCATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-464s1c1
Sequence:CCGGGTGGCTGTTGACATGGAATTTCTCGAGAAATTCCATGTCAACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-962s1c1
Sequence:CCGGGTCAACCAAGTACCCAAGATACTCGAGTATCTTGGGTACTTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025344
VALIDATED
EIF3F MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit F
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-659s21c1
Sequence:CCGGATGAGCATCAAGGCCTATGTCCTCGAGGACATAGGCCTTGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-1068s21c1
Sequence:CCGGAGATTGCCCTCAACGAGAAACCTCGAGGTTTCTCGTTGAGGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-734s21c1
Sequence:CCGGACAGTGAAGTACGCGTATTATCTCGAGATAATACGCGTACTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-578s21c1
Sequence:CCGGGTGCTGATCCATGAGTACTACCTCGAGGTAGTACTCATGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025344.1-859s21c1
Sequence:CCGGTCGCATCCAGGATGCTCTAAGCTCGAGCTTAGAGCATCCTGGATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-385s1c1
Sequence:CCGGCCTGTTGGGAACTGTTGACAACTCGAGTTGTCAACAGTTCCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-778s1c1
Sequence:CCGGCCTCATCATGAAGACGTGTTTCTCGAGAAACACGTCTTCATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-464s1c1
Sequence:CCGGGTGGCTGTTGACATGGAATTTCTCGAGAAATTCCATGTCAACAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025344.1-962s1c1
Sequence:CCGGGTCAACCAAGTACCCAAGATACTCGAGTATCTTGGGTACTTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks