EMAIL THIS PAGE TO A FRIEND

EIF3FP2

eukaryotic translation initiation factor 3, subunit F pseudogene 2

10 Gene Product Result for
Synonyms: IFP38
Species: Human EIF3FP2(83880)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031943 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017774 predicted 856
2 SASI_Hs01_00017775 predicted 638
3 SASI_Hs01_00017776 predicted 906
4 SASI_Hs01_00017777 predicted 421
5 SASI_Hs01_00017778 predicted 621
6 SASI_Hs01_00017779 predicted 420
7 SASI_Hs01_00017780 predicted 732
8 SASI_Hs01_00017781 predicted 1189
9 SASI_Hs01_00017782 predicted 869
10 SASI_Hs01_00017783 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031943
EIF3FP2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit F pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-421s1c1
Sequence:CCGGTCATACAATGAGTCAGATGAACTCGAGTTCATCTGACTCATTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-687s1c1
Sequence:CCGGCGTGGGAGTGTTCACACCTTTCTCGAGAAAGGTGTGAACACTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-871s1c1
Sequence:CCGGGCAGAGGATATACTATCTGCACTCGAGTGCAGATAGTATATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-872s1c1
Sequence:CCGGCAGAGGATATACTATCTGCAACTCGAGTTGCAGATAGTATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-633s1c1
Sequence:CCGGCCATATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031943
EIF3FP2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit F pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-421s1c1
Sequence:CCGGTCATACAATGAGTCAGATGAACTCGAGTTCATCTGACTCATTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-687s1c1
Sequence:CCGGCGTGGGAGTGTTCACACCTTTCTCGAGAAAGGTGTGAACACTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-871s1c1
Sequence:CCGGGCAGAGGATATACTATCTGCACTCGAGTGCAGATAGTATATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-872s1c1
Sequence:CCGGCAGAGGATATACTATCTGCAACTCGAGTTGCAGATAGTATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-633s1c1
Sequence:CCGGCCATATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031943
EIF3FP2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit F pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-421s1c1
Sequence:CCGGTCATACAATGAGTCAGATGAACTCGAGTTCATCTGACTCATTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-687s1c1
Sequence:CCGGCGTGGGAGTGTTCACACCTTTCTCGAGAAAGGTGTGAACACTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-871s1c1
Sequence:CCGGGCAGAGGATATACTATCTGCACTCGAGTGCAGATAGTATATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-872s1c1
Sequence:CCGGCAGAGGATATACTATCTGCAACTCGAGTTGCAGATAGTATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031943.1-633s1c1
Sequence:CCGGCCATATGAGCATCAAAGCCTACTCGAGTAGGCTTTGATGCTCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks