EMAIL THIS PAGE TO A FRIEND

EIF3FP3

eukaryotic translation initiation factor 3, subunit F pseudogene 3

30 Gene Product Result for
Species: Human EIF3FP3(339799)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_290345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_290345 Rosetta Predictions human pricing
XM_934417 Rosetta Predictions human pricing
XM_934419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248743 predicted 909
2 SASI_Hs01_00248744 predicted 778
3 SASI_Hs01_00248745 predicted 459
4 SASI_Hs01_00248746 predicted 553
5 SASI_Hs01_00248747 predicted 724
6 SASI_Hs01_00248748 predicted 458
7 SASI_Hs01_00248749 predicted 873
8 SASI_Hs01_00248750 predicted 1207
9 SASI_Hs01_00248751 predicted 1210
10 SASI_Hs01_00248752 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280679 predicted 914
2 SASI_Hs01_00280680 predicted 780
3 SASI_Hs01_00280681 predicted 459
4 SASI_Hs01_00280682 predicted 549
5 SASI_Hs01_00280683 predicted 725
6 SASI_Hs01_00280684 predicted 452
7 SASI_Hs01_00280685 predicted 879
8 SASI_Hs01_00280686 predicted 1205
9 SASI_Hs01_00280687 predicted 1212
10 SASI_Hs01_00280688 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288815 predicted 817
2 SASI_Hs01_00288816 predicted 681
3 SASI_Hs01_00288817 predicted 369
4 SASI_Hs01_00288818 predicted 453
5 SASI_Hs01_00288819 predicted 638
6 SASI_Hs01_00288820 predicted 779
7 SASI_Hs01_00288821 predicted 1120
8 SASI_Hs01_00288822 predicted 1117
9 SASI_Hs01_00288823 predicted 1117
10 SASI_Hs01_00288824 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290345
EIF3FP3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit F pseudogene 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-435s1c1
Sequence:CCGGCCGCACAATGAGTCAGAAGATCTCGAGATCTTCTGACTCATTGTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-651s1c1
Sequence:CCGGCGCATGAGCATCAAAGCCTATCTCGAGATAGGCTTTGATGCTCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-1056s1c1
Sequence:CCGGCAGTCACAGATTGCCCTCAATCTCGAGATTGAGGGCAATCTGTGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-468s1c1
Sequence:CCGGGACATGGAATTTGCTAAGAATCTCGAGATTCTTAGCAAATTCCATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-868s1c1
Sequence:CCGGCCCTGAGTACAGTGTTGCAATCTCGAGATTGCAACACTGTACTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290345
EIF3FP3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit F pseudogene 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-435s1c1
Sequence:CCGGCCGCACAATGAGTCAGAAGATCTCGAGATCTTCTGACTCATTGTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-651s1c1
Sequence:CCGGCGCATGAGCATCAAAGCCTATCTCGAGATAGGCTTTGATGCTCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-1056s1c1
Sequence:CCGGCAGTCACAGATTGCCCTCAATCTCGAGATTGAGGGCAATCTGTGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-468s1c1
Sequence:CCGGGACATGGAATTTGCTAAGAATCTCGAGATTCTTAGCAAATTCCATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-868s1c1
Sequence:CCGGCCCTGAGTACAGTGTTGCAATCTCGAGATTGCAACACTGTACTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290345
EIF3FP3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit F pseudogene 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-435s1c1
Sequence:CCGGCCGCACAATGAGTCAGAAGATCTCGAGATCTTCTGACTCATTGTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-651s1c1
Sequence:CCGGCGCATGAGCATCAAAGCCTATCTCGAGATAGGCTTTGATGCTCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-1056s1c1
Sequence:CCGGCAGTCACAGATTGCCCTCAATCTCGAGATTGAGGGCAATCTGTGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-468s1c1
Sequence:CCGGGACATGGAATTTGCTAAGAATCTCGAGATTCTTAGCAAATTCCATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290345.4-868s1c1
Sequence:CCGGCCCTGAGTACAGTGTTGCAATCTCGAGATTGCAACACTGTACTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)