EMAIL THIS PAGE TO A FRIEND

EIF3G

eukaryotic translation initiation factor 3, subunit G

52 Gene Product Result for
Synonyms: EIF3-P42 EIF3S4 eIF3-delta eIF3-p44
UniProtKB ID: O75821, O14801, Q969U5
Gene ID:
Mouse(53356) eukaryotic translation initiation factor 3, subunit G
Rat(298700) eukaryotic translation initiation factor 3, subunit G
Zebrafish(393974) eukaryotic translation initiation factor 3, subunit G
cow(615695) eukaryotic translation initiation factor 3, subunit G
domestic cat(101093250) eukaryotic translation initiation factor 3, subunit G
dog(612971) eukaryotic translation initiation factor 3, subunit G
chicken(777308) eukaryotic translation initiation factor 3, subunit G
chicken(101665981) eukaryotic translation initiation factor 3, subunit G
chicken(101747413) eukaryotic translation initiation factor 3, subunit G
domestic guinea pig(100717130) eukaryotic translation initiation factor 3, subunit G
naked mole-rat(101711643) eukaryotic translation initiation factor 3, subunit G
sheep(101111798) eukaryotic translation initiation factor 3, subunit G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068011 MISSION® esiRNA esiRNA targeting mouse Eif3g (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003755 Rosetta Predictions human pricing
NM_001013095 Rosetta Predictions rat pricing
NM_016876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336231 predicted 778
2 SASI_Hs01_00236986 predicted 328
3 SASI_Hs01_00236987 predicted 438
4 SASI_Hs01_00236988 predicted 673
5 SASI_Hs01_00236989 predicted 263
6 SASI_Hs01_00236990 predicted 489
7 SASI_Hs01_00236991 predicted 857
8 SASI_Hs01_00236992 predicted 221
9 SASI_Hs01_00236993 predicted 360
10 SASI_Hs01_00236994 predicted 786
11 SASI_Hs01_00236995 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049064 predicted 721
2 SASI_Rn01_00049065 predicted 803
3 SASI_Rn01_00049066 predicted 638
4 SASI_Rn01_00049067 predicted 752
5 SASI_Rn01_00049068 predicted 526
6 SASI_Rn01_00049069 predicted 207
7 SASI_Rn01_00049070 predicted 619
8 SASI_Rn01_00049071 predicted 437
9 SASI_Rn02_00200751 predicted 464
10 SASI_Rn01_00049073 predicted 474
11 SASI_Rn01_00049072 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032473 predicted 455
2 SASI_Mm02_00323681 predicted 811
3 SASI_Mm02_00323682 predicted 298
4 SASI_Mm01_00032474 predicted 222
5 SASI_Mm01_00032475 predicted 418
6 SASI_Mm02_00323683 predicted 539
7 SASI_Mm01_00032477 predicted 410
8 SASI_Mm02_00323684 predicted 420
9 SASI_Mm01_00032479 predicted 772
10 SASI_Mm02_00323685 predicted 300
11 SASI_Mm01_00032476 predicted 200
12 SASI_Mm01_00032478 predicted 253
13 SASI_Mm01_00032480 predicted 284
14 SASI_Mm01_00032481 predicted 748
15 SASI_Mm01_00032482 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003755
VALIDATED
EIF3G MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit G
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-255s1c1
Sequence:CCGGGAGTACAAGATAGATGAGGATCTCGAGATCCTCATCTATCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003755.2-488s1c1
Sequence:CCGGGAACAAACTCAAGGGCCAGAACTCGAGTTCTGGCCCTTGAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-222s1c1
Sequence:CCGGGAGGTCATCAACGGAAACATACTCGAGTATGTTTCCGTTGATGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-350s1c1
Sequence:CCGGGAACTGGAAGAAGTTCGGGAACTCGAGTTCCCGAACTTCTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003755.2-422s1c1
Sequence:CCGGCGATGTCTCTATGACGTTCATCTCGAGATGAACGTCATAGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-867s21c1
Sequence:CCGGTCTACCTGGCTAAGGACAAGACTCGAGTCTTGTCCTTAGCCAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-783s21c1
Sequence:CCGGCCATCCGTGTCACCAACTTGTCTCGAGACAAGTTGGTGACACGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-436s21c1
Sequence:CCGGCGATGTCTCTATGACGTTCATCTCGAGATGAACGTCATAGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-502s21c1
Sequence:CCGGGAACAAACTCAAGGGCCAGAACTCGAGTTCTGGCCCTTGAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-325s21c1
Sequence:CCGGTGAGACCCGGAAGGCTTCAAACTCGAGTTTGAAGCCTTCCGGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003755
VALIDATED
EIF3G MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit G
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-255s1c1
Sequence:CCGGGAGTACAAGATAGATGAGGATCTCGAGATCCTCATCTATCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003755.2-488s1c1
Sequence:CCGGGAACAAACTCAAGGGCCAGAACTCGAGTTCTGGCCCTTGAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-222s1c1
Sequence:CCGGGAGGTCATCAACGGAAACATACTCGAGTATGTTTCCGTTGATGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-350s1c1
Sequence:CCGGGAACTGGAAGAAGTTCGGGAACTCGAGTTCCCGAACTTCTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003755.2-422s1c1
Sequence:CCGGCGATGTCTCTATGACGTTCATCTCGAGATGAACGTCATAGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-867s21c1
Sequence:CCGGTCTACCTGGCTAAGGACAAGACTCGAGTCTTGTCCTTAGCCAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-783s21c1
Sequence:CCGGCCATCCGTGTCACCAACTTGTCTCGAGACAAGTTGGTGACACGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-436s21c1
Sequence:CCGGCGATGTCTCTATGACGTTCATCTCGAGATGAACGTCATAGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-502s21c1
Sequence:CCGGGAACAAACTCAAGGGCCAGAACTCGAGTTCTGGCCCTTGAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-325s21c1
Sequence:CCGGTGAGACCCGGAAGGCTTCAAACTCGAGTTTGAAGCCTTCCGGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003755
VALIDATED
EIF3G MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit G
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-255s1c1
Sequence:CCGGGAGTACAAGATAGATGAGGATCTCGAGATCCTCATCTATCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003755.2-488s1c1
Sequence:CCGGGAACAAACTCAAGGGCCAGAACTCGAGTTCTGGCCCTTGAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-222s1c1
Sequence:CCGGGAGGTCATCAACGGAAACATACTCGAGTATGTTTCCGTTGATGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003755.2-350s1c1
Sequence:CCGGGAACTGGAAGAAGTTCGGGAACTCGAGTTCCCGAACTTCTTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003755.2-422s1c1
Sequence:CCGGCGATGTCTCTATGACGTTCATCTCGAGATGAACGTCATAGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-867s21c1
Sequence:CCGGTCTACCTGGCTAAGGACAAGACTCGAGTCTTGTCCTTAGCCAGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-783s21c1
Sequence:CCGGCCATCCGTGTCACCAACTTGTCTCGAGACAAGTTGGTGACACGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-436s21c1
Sequence:CCGGCGATGTCTCTATGACGTTCATCTCGAGATGAACGTCATAGAGACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-502s21c1
Sequence:CCGGGAACAAACTCAAGGGCCAGAACTCGAGTTCTGGCCCTTGAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003755.3-325s21c1
Sequence:CCGGTGAGACCCGGAAGGCTTCAAACTCGAGTTTGAAGCCTTCCGGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016876
VALIDATED
EIF3G MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit G
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-232s1c1
Sequence:CCGGGAGTACAAGATAGAGGAAGATCTCGAGATCTTCCTCTATCTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-321s1c1
Sequence:CCGGGAGGAAGAATTGGAAGAAGTTCTCGAGAACTTCTTCCAATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016876.2-942s1c1
Sequence:CCGGCGACCATCTTATCCTCAATGTCTCGAGACATTGAGGATAAGATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-816s1c1
Sequence:CCGGCTCCATCTCCCGAATCTACTTCTCGAGAAGTAGATTCGGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-816s21c1
Sequence:CCGGCTCCATCTCCCGAATCTACTTCTCGAGAAGTAGATTCGGGAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-321s21c1
Sequence:CCGGGAGGAAGAATTGGAAGAAGTTCTCGAGAACTTCTTCCAATTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-232s21c1
Sequence:CCGGGAGTACAAGATAGAGGAAGATCTCGAGATCTTCCTCTATCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-942s21c1
Sequence:CCGGCGACCATCTTATCCTCAATGTCTCGAGACATTGAGGATAAGATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016876
VALIDATED
EIF3G MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit G
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-232s1c1
Sequence:CCGGGAGTACAAGATAGAGGAAGATCTCGAGATCTTCCTCTATCTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-321s1c1
Sequence:CCGGGAGGAAGAATTGGAAGAAGTTCTCGAGAACTTCTTCCAATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016876.2-942s1c1
Sequence:CCGGCGACCATCTTATCCTCAATGTCTCGAGACATTGAGGATAAGATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-816s1c1
Sequence:CCGGCTCCATCTCCCGAATCTACTTCTCGAGAAGTAGATTCGGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-816s21c1
Sequence:CCGGCTCCATCTCCCGAATCTACTTCTCGAGAAGTAGATTCGGGAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-321s21c1
Sequence:CCGGGAGGAAGAATTGGAAGAAGTTCTCGAGAACTTCTTCCAATTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-232s21c1
Sequence:CCGGGAGTACAAGATAGAGGAAGATCTCGAGATCTTCCTCTATCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-942s21c1
Sequence:CCGGCGACCATCTTATCCTCAATGTCTCGAGACATTGAGGATAAGATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016876
VALIDATED
EIF3G MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit G
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-232s1c1
Sequence:CCGGGAGTACAAGATAGAGGAAGATCTCGAGATCTTCCTCTATCTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-321s1c1
Sequence:CCGGGAGGAAGAATTGGAAGAAGTTCTCGAGAACTTCTTCCAATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016876.2-942s1c1
Sequence:CCGGCGACCATCTTATCCTCAATGTCTCGAGACATTGAGGATAAGATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016876.2-816s1c1
Sequence:CCGGCTCCATCTCCCGAATCTACTTCTCGAGAAGTAGATTCGGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-816s21c1
Sequence:CCGGCTCCATCTCCCGAATCTACTTCTCGAGAAGTAGATTCGGGAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-321s21c1
Sequence:CCGGGAGGAAGAATTGGAAGAAGTTCTCGAGAACTTCTTCCAATTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-232s21c1
Sequence:CCGGGAGTACAAGATAGAGGAAGATCTCGAGATCTTCCTCTATCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016876.3-942s21c1
Sequence:CCGGCGACCATCTTATCCTCAATGTCTCGAGACATTGAGGATAAGATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks