EMAIL THIS PAGE TO A FRIEND

EIF3H

eukaryotic translation initiation factor 3, subunit H

60 Gene Product Result for
Synonyms: EIF3S3 eIF3-gamma eIF3-p40
UniProtKB ID: O15372
Gene ID:
Mouse(68135) eukaryotic translation initiation factor 3, subunit H
Rat(299899) eukaryotic translation initiation factor 3, subunit H
chicken(420288) eukaryotic translation initiation factor 3, subunit H
dog(475081) eukaryotic translation initiation factor 3, subunit H
Horse(100065449) eukaryotic translation initiation factor 3, subunit H
cow(506873) eukaryotic translation initiation factor 3, subunit H
domestic cat(101095228) eukaryotic translation initiation factor 3, subunit H
sheep(101115801) eukaryotic translation initiation factor 3, subunit H
naked mole-rat(101703839) eukaryotic translation initiation factor 3, subunit H
domestic guinea pig(100719471) eukaryotic translation initiation factor 3, subunit H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003756 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003756 Rosetta Predictions human pricing
NM_198751 Rosetta Predictions rat pricing
NM_080635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072290 predicted 499
2 SASI_Hs01_00072291 predicted 589
3 SASI_Hs01_00072292 predicted 348
4 SASI_Hs01_00072294 predicted 619
5 SASI_Hs01_00072295 predicted 291
6 SASI_Hs01_00072297 predicted 245
7 SASI_Hs02_00336232 predicted 599
8 SASI_Hs02_00336233 predicted 228
9 SASI_Hs01_00072293 predicted 199
10 SASI_Hs01_00072296 predicted 596
11 SASI_Hs01_00072298 predicted 214
12 SASI_Hs01_00072299 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092079 predicted 389
2 SASI_Rn01_00092081 predicted 697
3 SASI_Rn01_00092082 predicted 978
4 SASI_Rn01_00092084 predicted 651
5 SASI_Rn02_00269974 predicted 604
6 SASI_Rn01_00092086 predicted 298
7 SASI_Rn02_00269975 predicted 524
8 SASI_Rn02_00269976 predicted 529
9 SASI_Rn02_00269977 predicted 975
10 SASI_Rn02_00269978 predicted 536
11 SASI_Rn01_00092077 predicted 531
12 SASI_Rn01_00092078 predicted 627
13 SASI_Rn01_00092080 predicted 605
14 SASI_Rn01_00092083 predicted 1007
15 SASI_Rn01_00092085 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057307 predicted 622
2 SASI_Mm01_00057308 predicted 749
3 SASI_Mm02_00338180 predicted 955
4 SASI_Mm01_00057312 predicted 673
5 SASI_Mm02_00338181 predicted 975
6 SASI_Mm02_00338182 predicted 822
7 SASI_Mm01_00057314 predicted 449
8 SASI_Mm01_00057315 predicted 471
9 SASI_Mm02_00338183 predicted 663
10 SASI_Mm01_00057316 predicted 444
11 SASI_Mm01_00057309 predicted 601
12 SASI_Mm01_00057310 predicted 587
13 SASI_Mm01_00057311 predicted 584
14 SASI_Mm01_00057313 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080635
VALIDATED
EIF3H MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit H
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-1085s21c1
Sequence:CCGGGCGTTGAGTAGACAGACTGTTCTCGAGAACAGTCTGTCTACTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080635.1-229s21c1
Sequence:CCGGGCTAGAGATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-791s21c1
Sequence:CCGGTACATGCGCAACACCAGTAAGCTCGAGCTTACTGGTGTTGCGCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-479s21c1
Sequence:CCGGCAAGGATCTCTCTCGCTGAAGCTCGAGCTTCAGCGAGAGAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-777s21c1
Sequence:CCGGTCAAATACAACACGTACATGCCTCGAGGCATGTACGTGTTGTATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-1085s1c1
Sequence:CCGGGCGTTGAGTAGACAGACTGTTCTCGAGAACAGTCTGTCTACTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-766s1c1
Sequence:CCGGCCAGGACATAATCAAATACAACTCGAGTTGTATTTGATTATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-500s1c1
Sequence:CCGGGCGTACAGACTGACTCCTAAACTCGAGTTTAGGAGTCAGTCTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-229s1c1
Sequence:CCGGGCTAGAGATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-357s1c1
Sequence:CCGGGCTGGTATCAGTCCACATATTCTCGAGAATATGTGGACTGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080635
VALIDATED
EIF3H MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit H
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-1085s21c1
Sequence:CCGGGCGTTGAGTAGACAGACTGTTCTCGAGAACAGTCTGTCTACTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080635.1-229s21c1
Sequence:CCGGGCTAGAGATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-791s21c1
Sequence:CCGGTACATGCGCAACACCAGTAAGCTCGAGCTTACTGGTGTTGCGCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-479s21c1
Sequence:CCGGCAAGGATCTCTCTCGCTGAAGCTCGAGCTTCAGCGAGAGAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-777s21c1
Sequence:CCGGTCAAATACAACACGTACATGCCTCGAGGCATGTACGTGTTGTATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-1085s1c1
Sequence:CCGGGCGTTGAGTAGACAGACTGTTCTCGAGAACAGTCTGTCTACTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-766s1c1
Sequence:CCGGCCAGGACATAATCAAATACAACTCGAGTTGTATTTGATTATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-500s1c1
Sequence:CCGGGCGTACAGACTGACTCCTAAACTCGAGTTTAGGAGTCAGTCTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-229s1c1
Sequence:CCGGGCTAGAGATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-357s1c1
Sequence:CCGGGCTGGTATCAGTCCACATATTCTCGAGAATATGTGGACTGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080635
VALIDATED
EIF3H MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit H
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-1085s21c1
Sequence:CCGGGCGTTGAGTAGACAGACTGTTCTCGAGAACAGTCTGTCTACTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080635.1-229s21c1
Sequence:CCGGGCTAGAGATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-791s21c1
Sequence:CCGGTACATGCGCAACACCAGTAAGCTCGAGCTTACTGGTGTTGCGCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-479s21c1
Sequence:CCGGCAAGGATCTCTCTCGCTGAAGCTCGAGCTTCAGCGAGAGAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080635.1-777s21c1
Sequence:CCGGTCAAATACAACACGTACATGCCTCGAGGCATGTACGTGTTGTATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-1085s1c1
Sequence:CCGGGCGTTGAGTAGACAGACTGTTCTCGAGAACAGTCTGTCTACTCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-766s1c1
Sequence:CCGGCCAGGACATAATCAAATACAACTCGAGTTGTATTTGATTATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-500s1c1
Sequence:CCGGGCGTACAGACTGACTCCTAAACTCGAGTTTAGGAGTCAGTCTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-229s1c1
Sequence:CCGGGCTAGAGATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080635.1-357s1c1
Sequence:CCGGGCTGGTATCAGTCCACATATTCTCGAGAATATGTGGACTGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003756
VALIDATED
EIF3H MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit H
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-1140s21c1
Sequence:CCGGGCAACTCTTGGAAGAAATATACTCGAGTATATTTCTTCCAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-499s21c1
Sequence:CCGGCCCAAGGATCTCTCTCACTAACTCGAGTTAGTGAGAGAGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-693s21c1
Sequence:CCGGGCTGTTGCAGATAAACATGAACTCGAGTTCATGTTTATCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-348s21c1
Sequence:CCGGCGCCATGTAAACATTGATCATCTCGAGATGATCAATGTTTACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-1119s1c1
Sequence:CCGGGCAACTCTTGGAAGAAATATACTCGAGTATATTTCTTCCAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003756.1-230s1c1
Sequence:CCGGGCTTGAAATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-478s1c1
Sequence:CCGGCCCAAGGATCTCTCTCACTAACTCGAGTTAGTGAGAGAGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-327s1c1
Sequence:CCGGCGCCATGTAAACATTGATCATCTCGAGATGATCAATGTTTACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-672s1c1
Sequence:CCGGGCTGTTGCAGATAAACATGAACTCGAGTTCATGTTTATCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003756
VALIDATED
EIF3H MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit H
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-1140s21c1
Sequence:CCGGGCAACTCTTGGAAGAAATATACTCGAGTATATTTCTTCCAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-499s21c1
Sequence:CCGGCCCAAGGATCTCTCTCACTAACTCGAGTTAGTGAGAGAGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-693s21c1
Sequence:CCGGGCTGTTGCAGATAAACATGAACTCGAGTTCATGTTTATCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-348s21c1
Sequence:CCGGCGCCATGTAAACATTGATCATCTCGAGATGATCAATGTTTACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-1119s1c1
Sequence:CCGGGCAACTCTTGGAAGAAATATACTCGAGTATATTTCTTCCAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003756.1-230s1c1
Sequence:CCGGGCTTGAAATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-478s1c1
Sequence:CCGGCCCAAGGATCTCTCTCACTAACTCGAGTTAGTGAGAGAGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-327s1c1
Sequence:CCGGCGCCATGTAAACATTGATCATCTCGAGATGATCAATGTTTACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-672s1c1
Sequence:CCGGGCTGTTGCAGATAAACATGAACTCGAGTTCATGTTTATCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003756
VALIDATED
EIF3H MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit H
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-1140s21c1
Sequence:CCGGGCAACTCTTGGAAGAAATATACTCGAGTATATTTCTTCCAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-499s21c1
Sequence:CCGGCCCAAGGATCTCTCTCACTAACTCGAGTTAGTGAGAGAGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-693s21c1
Sequence:CCGGGCTGTTGCAGATAAACATGAACTCGAGTTCATGTTTATCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003756.2-348s21c1
Sequence:CCGGCGCCATGTAAACATTGATCATCTCGAGATGATCAATGTTTACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-1119s1c1
Sequence:CCGGGCAACTCTTGGAAGAAATATACTCGAGTATATTTCTTCCAAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003756.1-230s1c1
Sequence:CCGGGCTTGAAATTACCAACTGCTTCTCGAGAAGCAGTTGGTAATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-478s1c1
Sequence:CCGGCCCAAGGATCTCTCTCACTAACTCGAGTTAGTGAGAGAGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-327s1c1
Sequence:CCGGCGCCATGTAAACATTGATCATCTCGAGATGATCAATGTTTACATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003756.1-672s1c1
Sequence:CCGGGCTGTTGCAGATAAACATGAACTCGAGTTCATGTTTATCTGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks