EMAIL THIS PAGE TO A FRIEND

EIF3I

eukaryotic translation initiation factor 3, subunit I

50 Gene Product Result for
Synonyms: EIF3S2 PRO2242 TRIP-1 TRIP1 eIF3-beta eIF3-p36
UniProtKB ID: Q13347
Gene ID:
Mouse(54709) eukaryotic translation initiation factor 3, subunit I
Rat(682390) eukaryotic translation initiation factor 3, subunit I
Zebrafish(406263) eukaryotic translation initiation factor 3, subunit I
dog(478152) eukaryotic translation initiation factor 3, subunit I
cow(521747) eukaryotic translation initiation factor 3, subunit I
Horse(100070298) eukaryotic translation initiation factor 3, subunit I
domestic cat(101098314) eukaryotic translation initiation factor 3, subunit I
chicken(419653) eukaryotic translation initiation factor 3, subunit I
domestic guinea pig(100729366) eukaryotic translation initiation factor 3, subunit I
naked mole-rat(101711310) eukaryotic translation initiation factor 3, subunit I
sheep(101115686) eukaryotic translation initiation factor 3, subunit I
Domestic Rabbit(100008959) eukaryotic translation initiation factor 3, subunit I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003757 Rosetta Predictions human pricing
NM_001115035 Rosetta Predictions rat pricing
NM_018799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198986 predicted 398
2 SASI_Hs01_00198988 predicted 269
3 SASI_Hs01_00198989 predicted 718
4 SASI_Hs01_00198990 predicted 655
5 SASI_Hs01_00198991 predicted 687
6 SASI_Hs01_00198992 predicted 579
7 SASI_Hs01_00198993 predicted 479
8 SASI_Hs01_00198994 predicted 630
9 SASI_Hs01_00198995 predicted 319
10 SASI_Hs02_00336234 predicted 282
11 SASI_Hs01_00198987 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252523 predicted 439
2 SASI_Rn02_00252524 predicted 780
3 SASI_Rn02_00252525 predicted 676
4 SASI_Rn02_00252526 predicted 600
5 SASI_Rn02_00252527 predicted 216
6 SASI_Rn02_00252528 predicted 561
7 SASI_Rn02_00252529 predicted 720
8 SASI_Rn02_00252530 predicted 829
9 SASI_Rn02_00252531 predicted 263
10 SASI_Rn02_00252532 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048773 predicted 440
2 SASI_Mm01_00048775 predicted 837
3 SASI_Mm01_00048776 predicted 631
4 SASI_Mm01_00048777 predicted 717
5 SASI_Mm01_00048778 predicted 513
6 SASI_Mm01_00048779 predicted 725
7 SASI_Mm01_00048780 predicted 249
8 SASI_Mm01_00048781 predicted 680
9 SASI_Mm01_00048782 predicted 424
10 SASI_Mm02_00324124 predicted 391
11 SASI_Mm01_00048774 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018799
VALIDATED
EIF3I MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018799.1-396s1c1
Sequence:CCGGTCAGTGCTTTGTGAGCTTCTTCTCGAGAAGAAGCTCACAAAGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-144s1c1
Sequence:CCGGCAACGTGTGGTACTCTGTCAACTCGAGTTGACAGAGTACCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-695s1c1
Sequence:CCGGCGACTCTTGAACATCAGAAGACTCGAGTCTTCTGATGTTCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-72s1c1
Sequence:CCGGGCGGTCCATCACGCAGATCAACTCGAGTTGATCTGCGTGATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018799.1-397s1c1
Sequence:CCGGCAGTGCTTTGTGAGCTTCTTTCTCGAGAAAGAAGCTCACAAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-111s21c1
Sequence:CCGGGCGAAGGAGACCTTCTCTTCACTCGAGTGAAGAGAAGGTCTCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-154s21c1
Sequence:CCGGCAACGTGTGGTACTCTGTCAACTCGAGTTGACAGAGTACCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-705s21c1
Sequence:CCGGCGACTCTTGAACATCAGAAGACTCGAGTCTTCTGATGTTCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-82s21c1
Sequence:CCGGGCGGTCCATCACGCAGATCAACTCGAGTTGATCTGCGTGATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-586s21c1
Sequence:CCGGAGAGGTGTTGGTGAACGTAAACTCGAGTTTACGTTCACCAACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018799
VALIDATED
EIF3I MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018799.1-396s1c1
Sequence:CCGGTCAGTGCTTTGTGAGCTTCTTCTCGAGAAGAAGCTCACAAAGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-144s1c1
Sequence:CCGGCAACGTGTGGTACTCTGTCAACTCGAGTTGACAGAGTACCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-695s1c1
Sequence:CCGGCGACTCTTGAACATCAGAAGACTCGAGTCTTCTGATGTTCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-72s1c1
Sequence:CCGGGCGGTCCATCACGCAGATCAACTCGAGTTGATCTGCGTGATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018799.1-397s1c1
Sequence:CCGGCAGTGCTTTGTGAGCTTCTTTCTCGAGAAAGAAGCTCACAAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-111s21c1
Sequence:CCGGGCGAAGGAGACCTTCTCTTCACTCGAGTGAAGAGAAGGTCTCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-154s21c1
Sequence:CCGGCAACGTGTGGTACTCTGTCAACTCGAGTTGACAGAGTACCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-705s21c1
Sequence:CCGGCGACTCTTGAACATCAGAAGACTCGAGTCTTCTGATGTTCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-82s21c1
Sequence:CCGGGCGGTCCATCACGCAGATCAACTCGAGTTGATCTGCGTGATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-586s21c1
Sequence:CCGGAGAGGTGTTGGTGAACGTAAACTCGAGTTTACGTTCACCAACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018799
VALIDATED
EIF3I MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018799.1-396s1c1
Sequence:CCGGTCAGTGCTTTGTGAGCTTCTTCTCGAGAAGAAGCTCACAAAGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-144s1c1
Sequence:CCGGCAACGTGTGGTACTCTGTCAACTCGAGTTGACAGAGTACCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-695s1c1
Sequence:CCGGCGACTCTTGAACATCAGAAGACTCGAGTCTTCTGATGTTCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018799.1-72s1c1
Sequence:CCGGGCGGTCCATCACGCAGATCAACTCGAGTTGATCTGCGTGATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018799.1-397s1c1
Sequence:CCGGCAGTGCTTTGTGAGCTTCTTTCTCGAGAAAGAAGCTCACAAAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-111s21c1
Sequence:CCGGGCGAAGGAGACCTTCTCTTCACTCGAGTGAAGAGAAGGTCTCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-154s21c1
Sequence:CCGGCAACGTGTGGTACTCTGTCAACTCGAGTTGACAGAGTACCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-705s21c1
Sequence:CCGGCGACTCTTGAACATCAGAAGACTCGAGTCTTCTGATGTTCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-82s21c1
Sequence:CCGGGCGGTCCATCACGCAGATCAACTCGAGTTGATCTGCGTGATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018799.2-586s21c1
Sequence:CCGGAGAGGTGTTGGTGAACGTAAACTCGAGTTTACGTTCACCAACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003757
VALIDATED
EIF3I MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003757.1-1233s1c1
Sequence:CCGGGTGAGCTGAGATCACGTCATTCTCGAGAATGACGTGATCTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-47s1c1
Sequence:CCGGGCGGTCCATTACGCAGATTAACTCGAGTTAATCTGCGTAATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-110s1c1
Sequence:CCGGCCCTATCGTCAATGTATGGTACTCGAGTACCATACATTGACGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-929s1c1
Sequence:CCGGCGAAGATGGTTACGTCCGTATCTCGAGATACGGACGTAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-950s1c1
Sequence:CCGGCCATTACTTCGACCCACAGTACTCGAGTACTGTGGGTCGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003757.2-1287s21c1
Sequence:CCGGGTGAGCTGAGATCACGTCATTCTCGAGAATGACGTGATCTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-1005s21c1
Sequence:CCGGCCATTACTTCGACCCACAGTACTCGAGTACTGTGGGTCGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-165s21c1
Sequence:CCGGCCCTATCGTCAATGTATGGTACTCGAGTACCATACATTGACGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-984s21c1
Sequence:CCGGCGAAGATGGTTACGTCCGTATCTCGAGATACGGACGTAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003757
VALIDATED
EIF3I MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003757.1-1233s1c1
Sequence:CCGGGTGAGCTGAGATCACGTCATTCTCGAGAATGACGTGATCTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-47s1c1
Sequence:CCGGGCGGTCCATTACGCAGATTAACTCGAGTTAATCTGCGTAATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-110s1c1
Sequence:CCGGCCCTATCGTCAATGTATGGTACTCGAGTACCATACATTGACGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-929s1c1
Sequence:CCGGCGAAGATGGTTACGTCCGTATCTCGAGATACGGACGTAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-950s1c1
Sequence:CCGGCCATTACTTCGACCCACAGTACTCGAGTACTGTGGGTCGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003757.2-1287s21c1
Sequence:CCGGGTGAGCTGAGATCACGTCATTCTCGAGAATGACGTGATCTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-1005s21c1
Sequence:CCGGCCATTACTTCGACCCACAGTACTCGAGTACTGTGGGTCGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-165s21c1
Sequence:CCGGCCCTATCGTCAATGTATGGTACTCGAGTACCATACATTGACGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-984s21c1
Sequence:CCGGCGAAGATGGTTACGTCCGTATCTCGAGATACGGACGTAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003757
VALIDATED
EIF3I MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003757.1-1233s1c1
Sequence:CCGGGTGAGCTGAGATCACGTCATTCTCGAGAATGACGTGATCTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-47s1c1
Sequence:CCGGGCGGTCCATTACGCAGATTAACTCGAGTTAATCTGCGTAATGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-110s1c1
Sequence:CCGGCCCTATCGTCAATGTATGGTACTCGAGTACCATACATTGACGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-929s1c1
Sequence:CCGGCGAAGATGGTTACGTCCGTATCTCGAGATACGGACGTAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003757.1-950s1c1
Sequence:CCGGCCATTACTTCGACCCACAGTACTCGAGTACTGTGGGTCGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003757.2-1287s21c1
Sequence:CCGGGTGAGCTGAGATCACGTCATTCTCGAGAATGACGTGATCTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-1005s21c1
Sequence:CCGGCCATTACTTCGACCCACAGTACTCGAGTACTGTGGGTCGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-165s21c1
Sequence:CCGGCCCTATCGTCAATGTATGGTACTCGAGTACCATACATTGACGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003757.2-984s21c1
Sequence:CCGGCGAAGATGGTTACGTCCGTATCTCGAGATACGGACGTAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks