EMAIL THIS PAGE TO A FRIEND

EIF3K

eukaryotic translation initiation factor 3, subunit K

63 Gene Product Result for
Synonyms: EIF3-p28 EIF3S12 HSPC029 M9 MSTP001 PLAC-24 PLAC24 PRO1474 PTD001
UniProtKB ID: Q9UBQ5, A8K0I9, Q96IQ0, Q9Y6D1
Gene ID:
Human(27335) Summary: The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex (Mayeur et al., 2003 [PubMed 14519125]
Mouse(73830) eukaryotic translation initiation factor 3, subunit K
Rat(292762) eukaryotic translation initiation factor 3, subunit K
Zebrafish(550245) eukaryotic translation initiation factor 3, subunit K
dog(476468) eukaryotic translation initiation factor 3, subunit K
Thale Cress(829461) translation initiation factor 3 subunit K
domestic cat(100169961) eukaryotic translation initiation factor 3, subunit K
cow(515326) eukaryotic translation initiation factor 3, subunit K
sheep(101111219) eukaryotic translation initiation factor 3, subunit K
naked mole-rat(101709919) eukaryotic translation initiation factor 3, subunit K
domestic guinea pig(100732824) eukaryotic translation initiation factor 3, subunit K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013234 Rosetta Predictions human pricing
NM_001106242 Rosetta Predictions rat pricing
XM_214886 Rosetta Predictions rat pricing
NM_028659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044794 predicted 340
2 SASI_Hs01_00044795 predicted 444
3 SASI_Hs01_00044797 predicted 535
4 SASI_Hs01_00044798 predicted 201
5 SASI_Hs01_00044799 predicted 616
6 SASI_Hs01_00044800 predicted 214
7 SASI_Hs01_00044802 predicted 400
8 SASI_Hs02_00344425 predicted 417
9 SASI_Hs01_00044803 predicted 406
10 SASI_Hs02_00344426 predicted 398
11 SASI_Hs01_00044796 predicted 589
12 SASI_Hs01_00044801 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217038 predicted 207
2 SASI_Rn02_00217039 predicted 214
3 SASI_Rn02_00217040 predicted 246
4 SASI_Rn02_00217041 predicted 224
5 SASI_Rn02_00217042 predicted 250
6 SASI_Rn02_00217043 predicted 336
7 SASI_Rn02_00217044 predicted 443
8 SASI_Rn02_00217045 predicted 378
9 SASI_Rn02_00217046 predicted 370
10 SASI_Rn02_00217047 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144118 predicted 1003
2 SASI_Rn01_00144119 predicted 912
3 SASI_Rn01_00144120 predicted 743
4 SASI_Rn01_00144121 predicted 1009
5 SASI_Rn01_00144122 predicted 343
6 SASI_Rn01_00144123 predicted 673
7 SASI_Rn01_00144124 predicted 999
8 SASI_Rn01_00144125 predicted 928
9 SASI_Rn01_00144126 predicted 200
10 SASI_Rn01_00144127 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095704 predicted 199
2 SASI_Mm02_00334185 predicted 322
3 SASI_Mm01_00095705 predicted 463
4 SASI_Mm01_00095706 predicted 457
5 SASI_Mm01_00095707 predicted 319
6 SASI_Mm01_00095708 predicted 343
7 SASI_Mm01_00095709 predicted 221
8 SASI_Mm02_00334186 predicted 469
9 SASI_Mm01_00095711 predicted 480
10 SASI_Mm01_00095712 predicted 316
11 SASI_Mm01_00095710 predicted 269
12 SASI_Mm01_00095713 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013234
VALIDATED
EIF3K MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit K
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-473s21c1
Sequence:CCGGGAACGGCCAATCCGACAGATTCTCGAGAATCTGTCGGATTGGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-601s21c1
Sequence:CCGGCCGAAAGTTTATCTGCCATGTCTCGAGACATGGCAGATAAACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-351s21c1
Sequence:CCGGAGTTCAACCCAGCCTTCTTTCCTCGAGGAAAGAAGGCTGGGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-572s21c1
Sequence:CCGGGAAGGTATAACTGGCTTTGAACTCGAGTTCAAAGCCAGTTATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013234.2-743s21c1
Sequence:CCGGCAGATCTTCATCTGTAGCCAACTCGAGTTGGCTACAGATGAAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-556s1c1
Sequence:CCGGGAAGGTATAACTGGCTTTGAACTCGAGTTCAAAGCCAGTTATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-727s1c1
Sequence:CCGGCAGATCTTCATCTGTAGCCAACTCGAGTTGGCTACAGATGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-585s1c1
Sequence:CCGGCCGAAAGTTTATCTGCCATGTCTCGAGACATGGCAGATAAACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-583s1c1
Sequence:CCGGGTCCGAAAGTTTATCTGCCATCTCGAGATGGCAGATAAACTTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013234
VALIDATED
EIF3K MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit K
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-473s21c1
Sequence:CCGGGAACGGCCAATCCGACAGATTCTCGAGAATCTGTCGGATTGGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-601s21c1
Sequence:CCGGCCGAAAGTTTATCTGCCATGTCTCGAGACATGGCAGATAAACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-351s21c1
Sequence:CCGGAGTTCAACCCAGCCTTCTTTCCTCGAGGAAAGAAGGCTGGGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-572s21c1
Sequence:CCGGGAAGGTATAACTGGCTTTGAACTCGAGTTCAAAGCCAGTTATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013234.2-743s21c1
Sequence:CCGGCAGATCTTCATCTGTAGCCAACTCGAGTTGGCTACAGATGAAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-556s1c1
Sequence:CCGGGAAGGTATAACTGGCTTTGAACTCGAGTTCAAAGCCAGTTATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-727s1c1
Sequence:CCGGCAGATCTTCATCTGTAGCCAACTCGAGTTGGCTACAGATGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-585s1c1
Sequence:CCGGCCGAAAGTTTATCTGCCATGTCTCGAGACATGGCAGATAAACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-583s1c1
Sequence:CCGGGTCCGAAAGTTTATCTGCCATCTCGAGATGGCAGATAAACTTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013234
VALIDATED
EIF3K MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit K
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-473s21c1
Sequence:CCGGGAACGGCCAATCCGACAGATTCTCGAGAATCTGTCGGATTGGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-601s21c1
Sequence:CCGGCCGAAAGTTTATCTGCCATGTCTCGAGACATGGCAGATAAACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-351s21c1
Sequence:CCGGAGTTCAACCCAGCCTTCTTTCCTCGAGGAAAGAAGGCTGGGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013234.2-572s21c1
Sequence:CCGGGAAGGTATAACTGGCTTTGAACTCGAGTTCAAAGCCAGTTATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013234.2-743s21c1
Sequence:CCGGCAGATCTTCATCTGTAGCCAACTCGAGTTGGCTACAGATGAAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-556s1c1
Sequence:CCGGGAAGGTATAACTGGCTTTGAACTCGAGTTCAAAGCCAGTTATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-727s1c1
Sequence:CCGGCAGATCTTCATCTGTAGCCAACTCGAGTTGGCTACAGATGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-585s1c1
Sequence:CCGGCCGAAAGTTTATCTGCCATGTCTCGAGACATGGCAGATAAACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_013234.1-583s1c1
Sequence:CCGGGTCCGAAAGTTTATCTGCCATCTCGAGATGGCAGATAAACTTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028659
VALIDATED
EIF3K MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit K
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-279s21c1
Sequence:CCGGCTGCCCAGATTCTGCTGAAAGCTCGAGCTTTCAGCAGAATCTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-459s21c1
Sequence:CCGGACCTTCTGGAAGGCATAACTGCTCGAGCAGTTATGCCTTCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-191s21c1
Sequence:CCGGGCCAAAGAGAATGCCTATGATCTCGAGATCATAGGCATTCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-129s21c1
Sequence:CCGGAGGGTATCGACAGGTACAATCCTCGAGGATTGTACCTGTCGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-322s21c1
Sequence:CCGGCGACTTCACTCTGTGTAAATGCTCGAGCATTTACACAGAGTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-140s1c1
Sequence:CCGGCAGGTACAATCCTGAGAACTTCTCGAGAAGTTCTCAGGATTGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-322s1c1
Sequence:CCGGCCGACTTCACTCTGTGTAAATCTCGAGATTTACACAGAGTGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-335s1c1
Sequence:CCGGGTGTAAATGTATGATCGACCACTCGAGTGGTCGATCATACATTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028659
VALIDATED
EIF3K MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit K
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-279s21c1
Sequence:CCGGCTGCCCAGATTCTGCTGAAAGCTCGAGCTTTCAGCAGAATCTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-459s21c1
Sequence:CCGGACCTTCTGGAAGGCATAACTGCTCGAGCAGTTATGCCTTCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-191s21c1
Sequence:CCGGGCCAAAGAGAATGCCTATGATCTCGAGATCATAGGCATTCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-129s21c1
Sequence:CCGGAGGGTATCGACAGGTACAATCCTCGAGGATTGTACCTGTCGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-322s21c1
Sequence:CCGGCGACTTCACTCTGTGTAAATGCTCGAGCATTTACACAGAGTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-140s1c1
Sequence:CCGGCAGGTACAATCCTGAGAACTTCTCGAGAAGTTCTCAGGATTGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-322s1c1
Sequence:CCGGCCGACTTCACTCTGTGTAAATCTCGAGATTTACACAGAGTGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-335s1c1
Sequence:CCGGGTGTAAATGTATGATCGACCACTCGAGTGGTCGATCATACATTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028659
VALIDATED
EIF3K MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit K
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-279s21c1
Sequence:CCGGCTGCCCAGATTCTGCTGAAAGCTCGAGCTTTCAGCAGAATCTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-459s21c1
Sequence:CCGGACCTTCTGGAAGGCATAACTGCTCGAGCAGTTATGCCTTCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-191s21c1
Sequence:CCGGGCCAAAGAGAATGCCTATGATCTCGAGATCATAGGCATTCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-129s21c1
Sequence:CCGGAGGGTATCGACAGGTACAATCCTCGAGGATTGTACCTGTCGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028659.2-322s21c1
Sequence:CCGGCGACTTCACTCTGTGTAAATGCTCGAGCATTTACACAGAGTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-140s1c1
Sequence:CCGGCAGGTACAATCCTGAGAACTTCTCGAGAAGTTCTCAGGATTGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-322s1c1
Sequence:CCGGCCGACTTCACTCTGTGTAAATCTCGAGATTTACACAGAGTGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028659.1-335s1c1
Sequence:CCGGGTGTAAATGTATGATCGACCACTCGAGTGGTCGATCATACATTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks