EMAIL THIS PAGE TO A FRIEND

EIF3L

eukaryotic translation initiation factor 3, subunit L

54 Gene Product Result for
Synonyms: EIF3EIP EIF3S11 EIF3S6IP HSPC021 HSPC025 MSTP005
Gene ID:
Mouse(223691) eukaryotic translation initiation factor 3, subunit L
Rat(300069) eukaryotic translation initiation factor 3, subunit L
chicken(418033) eukaryotic translation initiation factor 3, subunit L
cow(514449) eukaryotic translation initiation factor 3, subunit L
Horse(100054887) eukaryotic translation initiation factor 3, subunit L
domestic cat(101099386) eukaryotic translation initiation factor 3, subunit L
dog(474513) eukaryotic translation initiation factor 3, subunit L
domestic guinea pig(100724200) eukaryotic translation initiation factor 3, subunit L
naked mole-rat(101716021) eukaryotic translation initiation factor 3, subunit L
sheep(101102715) eukaryotic translation initiation factor 3, subunit L
Domestic Rabbit(100353994) eukaryotic translation initiation factor 3, subunit L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016091 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016091 Rosetta Predictions human pricing
NM_001034134 Rosetta Predictions rat pricing
NM_145139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055990 predicted 202
2 SASI_Hs01_00055991 predicted 1727
3 SASI_Hs01_00055992 predicted 568
4 SASI_Hs01_00055993 predicted 565
5 SASI_Hs01_00055994 predicted 636
6 SASI_Hs01_00055995 predicted 934
7 SASI_Hs01_00055996 predicted 1556
8 SASI_Hs01_00055997 predicted 1713
9 SASI_Hs01_00055998 predicted 548
10 SASI_Hs01_00055999 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081125 predicted 561
2 SASI_Rn01_00081126 predicted 347
3 SASI_Rn01_00081127 predicted 703
4 SASI_Rn01_00081128 predicted 615
5 SASI_Rn02_00203982 predicted 349
6 SASI_Rn01_00081129 predicted 742
7 SASI_Rn01_00081130 predicted 579
8 SASI_Rn01_00081131 predicted 1066
9 SASI_Rn01_00081133 predicted 1118
10 SASI_Rn02_00203983 predicted 242
11 SASI_Rn01_00081132 predicted 867
12 SASI_Rn01_00081134 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130274 predicted 1045
2 SASI_Mm01_00130275 predicted 404
3 SASI_Mm01_00130276 predicted 937
4 SASI_Mm02_00340536 predicted 442
5 SASI_Mm01_00130278 predicted 1158
6 SASI_Mm01_00130279 predicted 580
7 SASI_Mm01_00130280 predicted 428
8 SASI_Mm01_00130281 predicted 212
9 SASI_Mm01_00130282 predicted 1093
10 SASI_Mm01_00130283 predicted 981
11 SASI_Mm01_00130277 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016091
VALIDATED
EIF3L MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit L
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-1791s1c1
Sequence:CCGGACACACATTCAGGAACCTGTTCTCGAGAACAGGTTCCTGAATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-540s1c1
Sequence:CCGGGCAGAGGTTTGAATCCTATTACTCGAGTAATAGGATTCAAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-786s1c1
Sequence:CCGGCCTGGTAGACAAATCCAACATCTCGAGATGTTGGATTTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-636s1c1
Sequence:CCGGCTGGGATATTATCGATGAGTTCTCGAGAACTCATCGATAATATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-186s1c1
Sequence:CCGGCCTTGCTTATGAACGTCAGTACTCGAGTACTGACGTTCATAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-186s21c1
Sequence:CCGGCCTTGCTTATGAACGTCAGTACTCGAGTACTGACGTTCATAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-636s21c1
Sequence:CCGGCTGGGATATTATCGATGAGTTCTCGAGAACTCATCGATAATATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-1791s21c1
Sequence:CCGGACACACATTCAGGAACCTGTTCTCGAGAACAGGTTCCTGAATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-786s21c1
Sequence:CCGGCCTGGTAGACAAATCCAACATCTCGAGATGTTGGATTTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016091.2-540s21c1
Sequence:CCGGGCAGAGGTTTGAATCCTATTACTCGAGTAATAGGATTCAAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016091
VALIDATED
EIF3L MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit L
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-1791s1c1
Sequence:CCGGACACACATTCAGGAACCTGTTCTCGAGAACAGGTTCCTGAATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-540s1c1
Sequence:CCGGGCAGAGGTTTGAATCCTATTACTCGAGTAATAGGATTCAAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-786s1c1
Sequence:CCGGCCTGGTAGACAAATCCAACATCTCGAGATGTTGGATTTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-636s1c1
Sequence:CCGGCTGGGATATTATCGATGAGTTCTCGAGAACTCATCGATAATATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-186s1c1
Sequence:CCGGCCTTGCTTATGAACGTCAGTACTCGAGTACTGACGTTCATAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-186s21c1
Sequence:CCGGCCTTGCTTATGAACGTCAGTACTCGAGTACTGACGTTCATAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-636s21c1
Sequence:CCGGCTGGGATATTATCGATGAGTTCTCGAGAACTCATCGATAATATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-1791s21c1
Sequence:CCGGACACACATTCAGGAACCTGTTCTCGAGAACAGGTTCCTGAATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-786s21c1
Sequence:CCGGCCTGGTAGACAAATCCAACATCTCGAGATGTTGGATTTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016091.2-540s21c1
Sequence:CCGGGCAGAGGTTTGAATCCTATTACTCGAGTAATAGGATTCAAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016091
VALIDATED
EIF3L MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit L
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-1791s1c1
Sequence:CCGGACACACATTCAGGAACCTGTTCTCGAGAACAGGTTCCTGAATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-540s1c1
Sequence:CCGGGCAGAGGTTTGAATCCTATTACTCGAGTAATAGGATTCAAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-786s1c1
Sequence:CCGGCCTGGTAGACAAATCCAACATCTCGAGATGTTGGATTTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-636s1c1
Sequence:CCGGCTGGGATATTATCGATGAGTTCTCGAGAACTCATCGATAATATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016091.2-186s1c1
Sequence:CCGGCCTTGCTTATGAACGTCAGTACTCGAGTACTGACGTTCATAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-186s21c1
Sequence:CCGGCCTTGCTTATGAACGTCAGTACTCGAGTACTGACGTTCATAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-636s21c1
Sequence:CCGGCTGGGATATTATCGATGAGTTCTCGAGAACTCATCGATAATATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-1791s21c1
Sequence:CCGGACACACATTCAGGAACCTGTTCTCGAGAACAGGTTCCTGAATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016091.2-786s21c1
Sequence:CCGGCCTGGTAGACAAATCCAACATCTCGAGATGTTGGATTTGTCTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016091.2-540s21c1
Sequence:CCGGGCAGAGGTTTGAATCCTATTACTCGAGTAATAGGATTCAAACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145139
EIF3L MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit L
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-1015s1c1
Sequence:CCGGGCGTCGATATCAGGATGCTATCTCGAGATAGCATCCTGATATCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-340s1c1
Sequence:CCGGGCTAACTGAAAGGTTCTTCAACTCGAGTTGAAGAACCTTTCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-1507s1c1
Sequence:CCGGGCTCGTCTTCAAGCACAAGATCTCGAGATCTTGTGCTTGAAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-160s1c1
Sequence:CCGGGCAGCAGACATATCAGGTGATCTCGAGATCACCTGATATGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145139.2-1743s1c1
Sequence:CCGGCCACGAGTCAAGAACCTGTTTCTCGAGAAACAGGTTCTTGACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-160s21c1
Sequence:CCGGGCAGCAGACATATCAGGTGATCTCGAGATCACCTGATATGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-1015s21c1
Sequence:CCGGGCGTCGATATCAGGATGCTATCTCGAGATAGCATCCTGATATCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-340s21c1
Sequence:CCGGGCTAACTGAAAGGTTCTTCAACTCGAGTTGAAGAACCTTTCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145139.2-1743s21c1
Sequence:CCGGCCACGAGTCAAGAACCTGTTTCTCGAGAAACAGGTTCTTGACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-1507s21c1
Sequence:CCGGGCTCGTCTTCAAGCACAAGATCTCGAGATCTTGTGCTTGAAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145139
EIF3L MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit L
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-1015s1c1
Sequence:CCGGGCGTCGATATCAGGATGCTATCTCGAGATAGCATCCTGATATCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-340s1c1
Sequence:CCGGGCTAACTGAAAGGTTCTTCAACTCGAGTTGAAGAACCTTTCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-1507s1c1
Sequence:CCGGGCTCGTCTTCAAGCACAAGATCTCGAGATCTTGTGCTTGAAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-160s1c1
Sequence:CCGGGCAGCAGACATATCAGGTGATCTCGAGATCACCTGATATGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145139.2-1743s1c1
Sequence:CCGGCCACGAGTCAAGAACCTGTTTCTCGAGAAACAGGTTCTTGACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-160s21c1
Sequence:CCGGGCAGCAGACATATCAGGTGATCTCGAGATCACCTGATATGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-1015s21c1
Sequence:CCGGGCGTCGATATCAGGATGCTATCTCGAGATAGCATCCTGATATCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-340s21c1
Sequence:CCGGGCTAACTGAAAGGTTCTTCAACTCGAGTTGAAGAACCTTTCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145139.2-1743s21c1
Sequence:CCGGCCACGAGTCAAGAACCTGTTTCTCGAGAAACAGGTTCTTGACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-1507s21c1
Sequence:CCGGGCTCGTCTTCAAGCACAAGATCTCGAGATCTTGTGCTTGAAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145139
EIF3L MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit L
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-1015s1c1
Sequence:CCGGGCGTCGATATCAGGATGCTATCTCGAGATAGCATCCTGATATCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-340s1c1
Sequence:CCGGGCTAACTGAAAGGTTCTTCAACTCGAGTTGAAGAACCTTTCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-1507s1c1
Sequence:CCGGGCTCGTCTTCAAGCACAAGATCTCGAGATCTTGTGCTTGAAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145139.2-160s1c1
Sequence:CCGGGCAGCAGACATATCAGGTGATCTCGAGATCACCTGATATGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145139.2-1743s1c1
Sequence:CCGGCCACGAGTCAAGAACCTGTTTCTCGAGAAACAGGTTCTTGACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-160s21c1
Sequence:CCGGGCAGCAGACATATCAGGTGATCTCGAGATCACCTGATATGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-1015s21c1
Sequence:CCGGGCGTCGATATCAGGATGCTATCTCGAGATAGCATCCTGATATCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-340s21c1
Sequence:CCGGGCTAACTGAAAGGTTCTTCAACTCGAGTTGAAGAACCTTTCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145139.2-1743s21c1
Sequence:CCGGCCACGAGTCAAGAACCTGTTTCTCGAGAAACAGGTTCTTGACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145139.2-1507s21c1
Sequence:CCGGGCTCGTCTTCAAGCACAAGATCTCGAGATCTTGTGCTTGAAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks