EMAIL THIS PAGE TO A FRIEND

EIF3M

eukaryotic translation initiation factor 3, subunit M

Synonyms: B5 PCID1 TANGO7 hfl-B5
UniProtKB ID: Q7L2H7, A8K7X4, O60735, Q2F836, Q53HL6, Q9BXW1
Gene ID:
Human(10480) Summary: This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome. [provided by RefSeq, Dec 2011]
Mouse(98221) eukaryotic translation initiation factor 3, subunit M
Rat(295975) eukaryotic translation initiation factor 3, subunit M
Zebrafish(334626) eukaryotic translation initiation factor 3, subunit M
chicken(421602) eukaryotic translation initiation factor 3, subunit M
domestic cat(101088953) eukaryotic translation initiation factor 3, subunit M
cow(515543) eukaryotic translation initiation factor 3, subunit M
Horse(100072719) eukaryotic translation initiation factor 3, subunit M
dog(475950) eukaryotic translation initiation factor 3, subunit M
sheep(101121881) eukaryotic translation initiation factor 3, subunit M
naked mole-rat(101716051) eukaryotic translation initiation factor 3, subunit M
domestic guinea pig(100728110) eukaryotic translation initiation factor 3, subunit M
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500139 Anti-B5 Receptor/PCID1/EIF3M antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV48293 Anti-EIF3M antibody produced in rabbit IgG fraction of antiserum canine, bovine, zebrafish, horse, rabbit, mouse, guinea pig, human, rat
immunohistochemistry, western blot pricing
HPA031063 Anti-EIF3M antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006360 Rosetta Predictions human pricing
XM_001079651 Rosetta Predictions rat pricing
XM_215794 Rosetta Predictions rat pricing
NM_145380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242304 predicted 839
2 SASI_Hs01_00242306 predicted 976
3 SASI_Hs02_00341414 predicted 417
4 SASI_Hs01_00242308 predicted 655
5 SASI_Hs01_00242310 predicted 606
6 SASI_Hs01_00242311 predicted 554
7 SASI_Hs01_00242313 predicted 562
8 SASI_Hs02_00341415 predicted 641
9 SASI_Hs02_00341416 predicted 233
10 SASI_Hs02_00341417 predicted 380
11 SASI_Hs01_00242305 predicted 782
12 SASI_Hs01_00242307 predicted 278
13 SASI_Hs01_00242309 predicted 272
14 SASI_Hs01_00242312 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364995 predicted 958
2 SASI_Rn02_00364996 predicted 1162
3 SASI_Rn02_00364997 predicted 605
4 SASI_Rn02_00364998 predicted 928
5 SASI_Rn02_00364999 predicted 1065
6 SASI_Rn02_00365000 predicted 454
7 SASI_Rn02_00365001 predicted 983
8 SASI_Rn02_00365002 predicted 469
9 SASI_Rn02_00365003 predicted 927
10 SASI_Rn02_00365004 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376205 predicted 959
2 SASI_Rn02_00376206 predicted 1156
3 SASI_Rn02_00376207 predicted 604
4 SASI_Rn02_00376208 predicted 927
5 SASI_Rn02_00376209 predicted 1065
6 SASI_Rn02_00376210 predicted 461
7 SASI_Rn02_00376211 predicted 992
8 SASI_Rn02_00376212 predicted 472
9 SASI_Rn02_00376213 predicted 925
10 SASI_Rn02_00376214 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340692 predicted 746
2 SASI_Mm01_00040390 predicted 342
3 SASI_Mm01_00040392 predicted 652
4 SASI_Mm02_00340693 predicted 273
5 SASI_Mm01_00040394 predicted 973
6 SASI_Mm01_00040395 predicted 209
7 SASI_Mm01_00040396 predicted 409
8 SASI_Mm01_00040397 predicted 704
9 SASI_Mm01_00040398 predicted 870
10 SASI_Mm01_00040399 predicted 795
11 SASI_Mm01_00040391 predicted 407
12 SASI_Mm01_00040393 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006360
VALIDATED
EIF3M MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit M
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006360.3-658s21c1
Sequence:CCGGCAGGTGTATTGTACGAGCATTCTCGAGAATGCTCGTACAATACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006360.3-500s21c1
Sequence:CCGGGACTGGAATCTCACCACTGAACTCGAGTTCAGTGGTGAGATTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006360.3-408s21c1
Sequence:CCGGCAGTGTATTGCAGCCTTATTACTCGAGTAATAAGGCTGCAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006360.3-944s21c1
Sequence:CCGGCTTCAGATTGGAGCTGATGATCTCGAGATCATCAGCTCCAATCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006360.2-953s1c1
Sequence:CCGGCTTCAGATTGGAGCTGATGATCTCGAGATCATCAGCTCCAATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006360.2-619s1c1
Sequence:CCGGCGGAAGTTACACAGAGGACAACTCGAGTTGTCCTCTGTGTAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-509s1c1
Sequence:CCGGGACTGGAATCTCACCACTGAACTCGAGTTCAGTGGTGAGATTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006360.2-683s1c1
Sequence:CCGGGCATTGAAAGATCCAAATGCACTCGAGTGCATTTGGATCTTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-404s1c1
Sequence:CCGGCCTGTAAGATACACAGTGTATCTCGAGATACACTGTGTATCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006360.2-667s1c1
Sequence:CCGGCAGGTGTATTGTACGAGCATTCTCGAGAATGCTCGTACAATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-980s1c1
Sequence:CCGGGCATTTGTTATTGACGCCGTACTCGAGTACGGCGTCAATAACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006360
VALIDATED
EIF3M MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit M
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006360.3-658s21c1
Sequence:CCGGCAGGTGTATTGTACGAGCATTCTCGAGAATGCTCGTACAATACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006360.3-500s21c1
Sequence:CCGGGACTGGAATCTCACCACTGAACTCGAGTTCAGTGGTGAGATTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006360.3-408s21c1
Sequence:CCGGCAGTGTATTGCAGCCTTATTACTCGAGTAATAAGGCTGCAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006360.3-944s21c1
Sequence:CCGGCTTCAGATTGGAGCTGATGATCTCGAGATCATCAGCTCCAATCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006360.2-953s1c1
Sequence:CCGGCTTCAGATTGGAGCTGATGATCTCGAGATCATCAGCTCCAATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006360.2-619s1c1
Sequence:CCGGCGGAAGTTACACAGAGGACAACTCGAGTTGTCCTCTGTGTAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-509s1c1
Sequence:CCGGGACTGGAATCTCACCACTGAACTCGAGTTCAGTGGTGAGATTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006360.2-683s1c1
Sequence:CCGGGCATTGAAAGATCCAAATGCACTCGAGTGCATTTGGATCTTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-404s1c1
Sequence:CCGGCCTGTAAGATACACAGTGTATCTCGAGATACACTGTGTATCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006360.2-667s1c1
Sequence:CCGGCAGGTGTATTGTACGAGCATTCTCGAGAATGCTCGTACAATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-980s1c1
Sequence:CCGGGCATTTGTTATTGACGCCGTACTCGAGTACGGCGTCAATAACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006360
VALIDATED
EIF3M MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit M
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006360.3-658s21c1
Sequence:CCGGCAGGTGTATTGTACGAGCATTCTCGAGAATGCTCGTACAATACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006360.3-500s21c1
Sequence:CCGGGACTGGAATCTCACCACTGAACTCGAGTTCAGTGGTGAGATTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006360.3-408s21c1
Sequence:CCGGCAGTGTATTGCAGCCTTATTACTCGAGTAATAAGGCTGCAATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006360.3-944s21c1
Sequence:CCGGCTTCAGATTGGAGCTGATGATCTCGAGATCATCAGCTCCAATCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006360.2-953s1c1
Sequence:CCGGCTTCAGATTGGAGCTGATGATCTCGAGATCATCAGCTCCAATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006360.2-619s1c1
Sequence:CCGGCGGAAGTTACACAGAGGACAACTCGAGTTGTCCTCTGTGTAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-509s1c1
Sequence:CCGGGACTGGAATCTCACCACTGAACTCGAGTTCAGTGGTGAGATTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006360.2-683s1c1
Sequence:CCGGGCATTGAAAGATCCAAATGCACTCGAGTGCATTTGGATCTTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-404s1c1
Sequence:CCGGCCTGTAAGATACACAGTGTATCTCGAGATACACTGTGTATCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006360.2-667s1c1
Sequence:CCGGCAGGTGTATTGTACGAGCATTCTCGAGAATGCTCGTACAATACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006360.2-980s1c1
Sequence:CCGGGCATTTGTTATTGACGCCGTACTCGAGTACGGCGTCAATAACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145380
VALIDATED
EIF3M MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 3, subunit M
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-658s21c1
Sequence:CCGGGTGTATTGTGCGGGCACTAAACTCGAGTTTAGTGCCCGCACAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-158s1c1
Sequence:CCGGGTAGATTTAGCTCAGATTATTCTCGAGAATAATCTGAGCTAAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-701s1c1
Sequence:CCGGGACCATCTTCTTACTCTAAAGCTCGAGCTTTAGAGTAAGAAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-741s1c1
Sequence:CCGGGCGAGCTTATCCATGATTTATCTCGAGATAAATCATGGATAAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-741s21c1
Sequence:CCGGGCGAGCTTATCCATGATTTATCTCGAGATAAATCATGGATAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-700s21c1
Sequence:CCGGTGACCATCTTCTTACTCTAAACTCGAGTTTAGAGTAAGAAGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-158s21c1
Sequence:CCGGGTAGATTTAGCTCAGATTATTCTCGAGAATAATCTGAGCTAAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-596s21c1
Sequence:CCGGGTGGAATTGCTCGGGAGTTACCTCGAGGTAACTCCCGAGCAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.1-788s1c1
Sequence:CCGGGCATCGTATGTCAAGTTCTATCTCGAGATAGAACTTGACATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145380
VALIDATED
EIF3M MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 3, subunit M
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-658s21c1
Sequence:CCGGGTGTATTGTGCGGGCACTAAACTCGAGTTTAGTGCCCGCACAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-158s1c1
Sequence:CCGGGTAGATTTAGCTCAGATTATTCTCGAGAATAATCTGAGCTAAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-701s1c1
Sequence:CCGGGACCATCTTCTTACTCTAAAGCTCGAGCTTTAGAGTAAGAAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-741s1c1
Sequence:CCGGGCGAGCTTATCCATGATTTATCTCGAGATAAATCATGGATAAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-741s21c1
Sequence:CCGGGCGAGCTTATCCATGATTTATCTCGAGATAAATCATGGATAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-700s21c1
Sequence:CCGGTGACCATCTTCTTACTCTAAACTCGAGTTTAGAGTAAGAAGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-158s21c1
Sequence:CCGGGTAGATTTAGCTCAGATTATTCTCGAGAATAATCTGAGCTAAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-596s21c1
Sequence:CCGGGTGGAATTGCTCGGGAGTTACCTCGAGGTAACTCCCGAGCAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.1-788s1c1
Sequence:CCGGGCATCGTATGTCAAGTTCTATCTCGAGATAGAACTTGACATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145380
VALIDATED
EIF3M MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 3, subunit M
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-658s21c1
Sequence:CCGGGTGTATTGTGCGGGCACTAAACTCGAGTTTAGTGCCCGCACAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-158s1c1
Sequence:CCGGGTAGATTTAGCTCAGATTATTCTCGAGAATAATCTGAGCTAAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-701s1c1
Sequence:CCGGGACCATCTTCTTACTCTAAAGCTCGAGCTTTAGAGTAAGAAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.2-741s1c1
Sequence:CCGGGCGAGCTTATCCATGATTTATCTCGAGATAAATCATGGATAAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-741s21c1
Sequence:CCGGGCGAGCTTATCCATGATTTATCTCGAGATAAATCATGGATAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-700s21c1
Sequence:CCGGTGACCATCTTCTTACTCTAAACTCGAGTTTAGAGTAAGAAGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-158s21c1
Sequence:CCGGGTAGATTTAGCTCAGATTATTCTCGAGAATAATCTGAGCTAAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145380.2-596s21c1
Sequence:CCGGGTGGAATTGCTCGGGAGTTACCTCGAGGTAACTCCCGAGCAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145380.1-788s1c1
Sequence:CCGGGCATCGTATGTCAAGTTCTATCTCGAGATAGAACTTGACATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks