EMAIL THIS PAGE TO A FRIEND

EIF4A1

eukaryotic translation initiation factor 4A1

108 Gene Product Result for
Synonyms: DDX2A EIF-4A EIF4A eIF-4A-I eIF4A-I
Gene ID:
Mouse(13681) eukaryotic translation initiation factor 4A1
Rat(287436) eukaryotic translation initiation factor 4A1
sheep(101123643) eukaryotic translation initiation factor 4A1
Domestic Rabbit(100355889) eukaryotic translation initiation factor 4A1
domestic guinea pig(100713267) eukaryotic translation initiation factor 4A1
naked mole-rat(101697673) eukaryotic translation initiation factor 4A1
Thale Cress(820605) translational initiation factor 4A-1
domestic cat(101098175) eukaryotic translation initiation factor 4A1
cow(504958) eukaryotic translation initiation factor 4A1
Horse(100061902) eukaryotic translation initiation factor 4A1
dog(100688577) eukaryotic translation initiation factor 4A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001416 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111501 MISSION® esiRNA esiRNA human EIF4A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001416 Rosetta Predictions human pricing
NM_199372 Rosetta Predictions rat pricing
NM_144958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331808 predicted 371
2 SASI_Hs02_00331809 predicted 1203
3 SASI_Hs02_00331810 predicted 671
4 SASI_Hs02_00331811 predicted 239
5 SASI_Hs02_00331812 predicted 747
6 SASI_Hs02_00331813 predicted 583
7 SASI_Hs02_00331814 predicted 1049
8 SASI_Hs02_00331815 predicted 1050
9 SASI_Hs02_00331816 predicted 625
10 SASI_Hs02_00331817 predicted 680
11 SASI_Hs01_00085813 predicted 222
12 SASI_Hs01_00085814 predicted 249
13 SASI_Hs01_00085815 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071176 predicted 520
2 SASI_Rn01_00071181 predicted 397
3 SASI_Rn01_00071183 predicted 834
4 SASI_Rn01_00071174 predicted 593
5 SASI_Rn01_00071175 predicted 267
6 SASI_Rn01_00071177 predicted 680
7 SASI_Rn01_00071178 predicted 666
8 SASI_Rn01_00071179 predicted 527
9 SASI_Rn01_00071182 predicted 294
10 SASI_Rn02_00270179 predicted 279
11 SASI_Rn01_00071180 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020023 predicted 1106
2 SASI_Mm02_00340482 predicted 708
3 SASI_Mm02_00340483 predicted 709
4 SASI_Mm01_00020021 predicted 1027
5 SASI_Mm01_00020022 predicted 1029
6 SASI_Mm02_00340484 predicted 697
7 SASI_Mm02_00340485 predicted 658
8 SASI_Mm02_00340486 predicted 701
9 SASI_Mm01_00020024 predicted 96
10 SASI_Mm01_00020025 predicted 1120
11 SASI_Mm01_00020026 predicted 104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144958
VALIDATED
EIF4A1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4A1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144958.2-1595s1c1
Sequence:CCGGGCCTCATTTGCTGGACCAAATCTCGAGATTTGGTCCAGCAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144958.2-1129s1c1
Sequence:CCGGGCTATTAACATGGTGACCGAACTCGAGTTCGGTCACCATGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144958.2-84s1c1
Sequence:CCGGCGAGAGTAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144958.2-600s1c1
Sequence:CCGGGATCTATGACATATTCCAGAACTCGAGTTCTGGAATATGTCATAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144958.2-195s1c1
Sequence:CCGGGCGAGCTATTCTTCCTTGTATCTCGAGATACAAGGAAGAATAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144958.4-1620s21c1
Sequence:CCGGCCTAGTCACCTCGTTCCTAAACTCGAGTTTAGGAACGAGGTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-191s21c1
Sequence:CCGGCGAGAGTAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-707s21c1
Sequence:CCGGGATCTATGACATATTCCAGAACTCGAGTTCTGGAATATGTCATAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-1144s21c1
Sequence:CCGGTCTCCTTAGTCATCAACTATGCTCGAGCATAGTTGATGACTAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144958
VALIDATED
EIF4A1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4A1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144958.2-1595s1c1
Sequence:CCGGGCCTCATTTGCTGGACCAAATCTCGAGATTTGGTCCAGCAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144958.2-1129s1c1
Sequence:CCGGGCTATTAACATGGTGACCGAACTCGAGTTCGGTCACCATGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144958.2-84s1c1
Sequence:CCGGCGAGAGTAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144958.2-600s1c1
Sequence:CCGGGATCTATGACATATTCCAGAACTCGAGTTCTGGAATATGTCATAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144958.2-195s1c1
Sequence:CCGGGCGAGCTATTCTTCCTTGTATCTCGAGATACAAGGAAGAATAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144958.4-1620s21c1
Sequence:CCGGCCTAGTCACCTCGTTCCTAAACTCGAGTTTAGGAACGAGGTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-191s21c1
Sequence:CCGGCGAGAGTAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-707s21c1
Sequence:CCGGGATCTATGACATATTCCAGAACTCGAGTTCTGGAATATGTCATAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-1144s21c1
Sequence:CCGGTCTCCTTAGTCATCAACTATGCTCGAGCATAGTTGATGACTAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144958
VALIDATED
EIF4A1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4A1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144958.2-1595s1c1
Sequence:CCGGGCCTCATTTGCTGGACCAAATCTCGAGATTTGGTCCAGCAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144958.2-1129s1c1
Sequence:CCGGGCTATTAACATGGTGACCGAACTCGAGTTCGGTCACCATGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144958.2-84s1c1
Sequence:CCGGCGAGAGTAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144958.2-600s1c1
Sequence:CCGGGATCTATGACATATTCCAGAACTCGAGTTCTGGAATATGTCATAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144958.2-195s1c1
Sequence:CCGGGCGAGCTATTCTTCCTTGTATCTCGAGATACAAGGAAGAATAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144958.4-1620s21c1
Sequence:CCGGCCTAGTCACCTCGTTCCTAAACTCGAGTTTAGGAACGAGGTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-191s21c1
Sequence:CCGGCGAGAGTAACTGGAACGAGATCTCGAGATCTCGTTCCAGTTACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-707s21c1
Sequence:CCGGGATCTATGACATATTCCAGAACTCGAGTTCTGGAATATGTCATAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144958.4-1144s21c1
Sequence:CCGGTCTCCTTAGTCATCAACTATGCTCGAGCATAGTTGATGACTAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001416
VALIDATED
EIF4A1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-495s1c1
Sequence:CCGGGCCGTGTGTTTGATATGCTTACTCGAGTAAGCATATCAAACACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-1116s1c1
Sequence:CCGGGCCGTAAAGGTGTGGCTATTACTCGAGTAATAGCCACACCTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-1030s1c1
Sequence:CCGGGCAGCAGGTTTCTTTAGTCATCTCGAGATGACTAAAGAAACCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-209s1c1
Sequence:CCGGCCTTGTATCAAGGGTTATGATCTCGAGATCATAACCCTTGATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-1203s21c1
Sequence:CCGGGCCGTAAAGGTGTGGCTATTACTCGAGTAATAGCCACACCTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-296s21c1
Sequence:CCGGCCTTGTATCAAGGGTTATGATCTCGAGATCATAACCCTTGATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-582s21c1
Sequence:CCGGGCCGTGTGTTTGATATGCTTACTCGAGTAAGCATATCAAACACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-1029s21c1
Sequence:CCGGAGGAACGAGACGTGATTATGACTCGAGTCATAATCACGTCTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001416.2-1562s21c1
Sequence:CCGGCCATTTCCCTAACCTAGTAACCTCGAGGTTACTAGGTTAGGGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001416
VALIDATED
EIF4A1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-495s1c1
Sequence:CCGGGCCGTGTGTTTGATATGCTTACTCGAGTAAGCATATCAAACACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-1116s1c1
Sequence:CCGGGCCGTAAAGGTGTGGCTATTACTCGAGTAATAGCCACACCTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-1030s1c1
Sequence:CCGGGCAGCAGGTTTCTTTAGTCATCTCGAGATGACTAAAGAAACCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-209s1c1
Sequence:CCGGCCTTGTATCAAGGGTTATGATCTCGAGATCATAACCCTTGATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-1203s21c1
Sequence:CCGGGCCGTAAAGGTGTGGCTATTACTCGAGTAATAGCCACACCTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-296s21c1
Sequence:CCGGCCTTGTATCAAGGGTTATGATCTCGAGATCATAACCCTTGATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-582s21c1
Sequence:CCGGGCCGTGTGTTTGATATGCTTACTCGAGTAAGCATATCAAACACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-1029s21c1
Sequence:CCGGAGGAACGAGACGTGATTATGACTCGAGTCATAATCACGTCTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001416.2-1562s21c1
Sequence:CCGGCCATTTCCCTAACCTAGTAACCTCGAGGTTACTAGGTTAGGGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001416
VALIDATED
EIF4A1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-495s1c1
Sequence:CCGGGCCGTGTGTTTGATATGCTTACTCGAGTAAGCATATCAAACACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-1116s1c1
Sequence:CCGGGCCGTAAAGGTGTGGCTATTACTCGAGTAATAGCCACACCTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-1030s1c1
Sequence:CCGGGCAGCAGGTTTCTTTAGTCATCTCGAGATGACTAAAGAAACCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001416.1-209s1c1
Sequence:CCGGCCTTGTATCAAGGGTTATGATCTCGAGATCATAACCCTTGATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-1203s21c1
Sequence:CCGGGCCGTAAAGGTGTGGCTATTACTCGAGTAATAGCCACACCTTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-296s21c1
Sequence:CCGGCCTTGTATCAAGGGTTATGATCTCGAGATCATAACCCTTGATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-582s21c1
Sequence:CCGGGCCGTGTGTTTGATATGCTTACTCGAGTAAGCATATCAAACACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001416.2-1029s21c1
Sequence:CCGGAGGAACGAGACGTGATTATGACTCGAGTCATAATCACGTCTCGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001416.2-1562s21c1
Sequence:CCGGCCATTTCCCTAACCTAGTAACCTCGAGGTTACTAGGTTAGGGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks