EMAIL THIS PAGE TO A FRIEND

EIF4A2

eukaryotic translation initiation factor 4A2

130 Gene Product Result for
Synonyms: BM-010 DDX2B EIF4A EIF4F eIF-4A-II eIF4A-II
UniProtKB ID: Q14240, D3DNU9, Q53XJ6, Q96B90, Q96EA8
Gene ID:
Mouse(13682) eukaryotic translation initiation factor 4A2
Rat(303831) eukaryotic translation initiation factor 4A2
Zebrafish(406760) eukaryotic translation initiation factor 4A, isoform 2
chicken(395232) eukaryotic translation initiation factor 4A2
dog(488118) eukaryotic translation initiation factor 4A2
Horse(100068164) eukaryotic translation initiation factor 4A2
cow(286819) eukaryotic translation initiation factor 4A2
domestic cat(101098327) eukaryotic translation initiation factor 4A2
naked mole-rat(101719864) eukaryotic translation initiation factor 4A2
domestic guinea pig(100729485) eukaryotic translation initiation factor 4A2
Domestic Rabbit(100328965) eukaryotic translation initiation factor 4A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001967 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001967 Rosetta Predictions human pricing
NM_001008335 Rosetta Predictions rat pricing
NM_001123037 Rosetta Predictions mouse pricing
NM_001123038 Rosetta Predictions mouse pricing
NM_013506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119367 predicted 1053
2 SASI_Hs01_00119368 predicted 983
3 SASI_Hs01_00119369 predicted 206
4 SASI_Hs01_00119371 predicted 216
5 SASI_Hs01_00119372 predicted 973
6 SASI_Hs02_00332925 predicted 1181
7 SASI_Hs01_00119373 predicted 1313
8 SASI_Hs01_00119374 predicted 453
9 SASI_Hs01_00119375 predicted 655
10 SASI_Hs02_00332926 predicted 205
11 SASI_Hs01_00119370 predicted 737
12 SASI_Hs01_00119376 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122367 predicted 428
2 SASI_Rn01_00122369 predicted 1132
3 SASI_Rn01_00122370 predicted 1186
4 SASI_Rn02_00199080 predicted 1178
5 SASI_Rn02_00199081 predicted 1052
6 SASI_Rn02_00199082 predicted 665
7 SASI_Rn01_00122373 predicted 634
8 SASI_Rn01_00122375 predicted 701
9 SASI_Rn01_00122376 predicted 713
10 SASI_Rn02_00199083 predicted 505
11 SASI_Rn01_00122368 predicted 807
12 SASI_Rn01_00122371 predicted 1170
13 SASI_Rn01_00122372 predicted 640
14 SASI_Rn01_00122374 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309779 predicted 787
2 SASI_Mm02_00309780 predicted 824
3 SASI_Mm02_00309781 predicted 856
4 SASI_Mm02_00309782 predicted 859
5 SASI_Mm02_00309783 predicted 954
6 SASI_Mm02_00309784 predicted 956
7 SASI_Mm02_00309785 predicted 889
8 SASI_Mm02_00309786 predicted 782
9 SASI_Mm02_00309787 predicted 978
10 SASI_Mm02_00309788 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309789 predicted 930
2 SASI_Mm02_00309790 predicted 968
3 SASI_Mm02_00309791 predicted 964
4 SASI_Mm02_00309792 predicted 925
5 SASI_Mm02_00309793 predicted 991
6 SASI_Mm02_00309794 predicted 999
7 SASI_Mm02_00309795 predicted 969
8 SASI_Mm02_00309796 predicted 960
9 SASI_Mm02_00309797 predicted 938
10 SASI_Mm02_00309798 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322162 predicted 931
2 SASI_Mm01_00125734 predicted 956
3 SASI_Mm01_00125735 predicted 991
4 SASI_Mm01_00125736 predicted 1002
5 SASI_Mm02_00322163 predicted 1096
6 SASI_Mm02_00322164 predicted 1096
7 SASI_Mm02_00322165 predicted 1025
8 SASI_Mm02_00322166 predicted 921
9 SASI_Mm02_00322167 predicted 1123
10 SASI_Mm02_00322168 predicted 893
11 SASI_Mm01_00125729 predicted 448
12 SASI_Mm01_00125730 predicted 1159
13 SASI_Mm01_00125731 predicted 227
14 SASI_Mm01_00125732 predicted 1205
15 SASI_Mm01_00125733 predicted 1054
16 SASI_Mm01_00125737 predicted 1081
17 SASI_Mm01_00125738 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001967
VALIDATED
EIF4A2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4A2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1009s21c1
Sequence:CCGGAGTCGTGTTCTGATCACTACTCTCGAGAGTAGTGATCAGAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1042s21c1
Sequence:CCGGCGCGGGATTGATGTGCAACAACTCGAGTTGTTGCACATCAATCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001967.3-519s21c1
Sequence:CCGGCGGGAGAGTGTTTGATATGTTCTCGAGAACATATCAAACACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001967.3-224s21c1
Sequence:CCGGGAGCTATTATTCCCTGTATTACTCGAGTAATACAGGGAATAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-854s21c1
Sequence:CCGGCCATTACACAGGCTGTTATTTCTCGAGAAATAACAGCCTGTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1309s21c1
Sequence:CCGGAGGCGATCACAACGTGCATTGCTCGAGCAATGCACGTTGTGATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001967.2-211s1c1
Sequence:CCGGCCCTGTATTAAAGGGTATGATCTCGAGATCATACCCTTTAATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001967.2-709s1c1
Sequence:CCGGCCAATTCGAATTCTGGTGAAACTCGAGTTTCACCAGAATTCGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-830s1c1
Sequence:CCGGCCATTACACAGGCTGTTATTTCTCGAGAAATAACAGCCTGTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-1018s1c1
Sequence:CCGGCGCGGGATTGATGTGCAACAACTCGAGTTGTTGCACATCAATCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-495s1c1
Sequence:CCGGCGGGAGAGTGTTTGATATGTTCTCGAGAACATATCAAACACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001967
VALIDATED
EIF4A2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4A2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1009s21c1
Sequence:CCGGAGTCGTGTTCTGATCACTACTCTCGAGAGTAGTGATCAGAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1042s21c1
Sequence:CCGGCGCGGGATTGATGTGCAACAACTCGAGTTGTTGCACATCAATCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001967.3-519s21c1
Sequence:CCGGCGGGAGAGTGTTTGATATGTTCTCGAGAACATATCAAACACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001967.3-224s21c1
Sequence:CCGGGAGCTATTATTCCCTGTATTACTCGAGTAATACAGGGAATAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-854s21c1
Sequence:CCGGCCATTACACAGGCTGTTATTTCTCGAGAAATAACAGCCTGTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1309s21c1
Sequence:CCGGAGGCGATCACAACGTGCATTGCTCGAGCAATGCACGTTGTGATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001967.2-211s1c1
Sequence:CCGGCCCTGTATTAAAGGGTATGATCTCGAGATCATACCCTTTAATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001967.2-709s1c1
Sequence:CCGGCCAATTCGAATTCTGGTGAAACTCGAGTTTCACCAGAATTCGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-830s1c1
Sequence:CCGGCCATTACACAGGCTGTTATTTCTCGAGAAATAACAGCCTGTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-1018s1c1
Sequence:CCGGCGCGGGATTGATGTGCAACAACTCGAGTTGTTGCACATCAATCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-495s1c1
Sequence:CCGGCGGGAGAGTGTTTGATATGTTCTCGAGAACATATCAAACACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001967
VALIDATED
EIF4A2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4A2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1009s21c1
Sequence:CCGGAGTCGTGTTCTGATCACTACTCTCGAGAGTAGTGATCAGAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1042s21c1
Sequence:CCGGCGCGGGATTGATGTGCAACAACTCGAGTTGTTGCACATCAATCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001967.3-519s21c1
Sequence:CCGGCGGGAGAGTGTTTGATATGTTCTCGAGAACATATCAAACACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001967.3-224s21c1
Sequence:CCGGGAGCTATTATTCCCTGTATTACTCGAGTAATACAGGGAATAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-854s21c1
Sequence:CCGGCCATTACACAGGCTGTTATTTCTCGAGAAATAACAGCCTGTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001967.3-1309s21c1
Sequence:CCGGAGGCGATCACAACGTGCATTGCTCGAGCAATGCACGTTGTGATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001967.2-211s1c1
Sequence:CCGGCCCTGTATTAAAGGGTATGATCTCGAGATCATACCCTTTAATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001967.2-709s1c1
Sequence:CCGGCCAATTCGAATTCTGGTGAAACTCGAGTTTCACCAGAATTCGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-830s1c1
Sequence:CCGGCCATTACACAGGCTGTTATTTCTCGAGAAATAACAGCCTGTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-1018s1c1
Sequence:CCGGCGCGGGATTGATGTGCAACAACTCGAGTTGTTGCACATCAATCCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001967.2-495s1c1
Sequence:CCGGCGGGAGAGTGTTTGATATGTTCTCGAGAACATATCAAACACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013506
VALIDATED
EIF4A2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4A2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-1037s21c1
Sequence:CCGGTTGACCCTTGAAGGAATTAAACTCGAGTTTAATTCCTTCAAGGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-676s21c1
Sequence:CCGGTTTGGCTCTTGGAGATTATATCTCGAGATATAATCTCCAAGAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-796s21c1
Sequence:CCGGGAGAGTGTTTGATATGCTAAACTCGAGTTTAGCATATCAAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-486s21c1
Sequence:CCGGCTATTCAGCAAAGAGCTATTACTCGAGTAATAGCTCTTTGCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013506.2-723s21c1
Sequence:CCGGGAGGAACAAATGTTCGAAATGCTCGAGCATTTCGAACATTTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013506.1-1638s1c1
Sequence:CCGGGCCTTTATTGTGTTTGTCATTCTCGAGAATGACAAACACAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013506.1-209s1c1
Sequence:CCGGCTATTCAGCAAAGAGCTATTACTCGAGTAATAGCTCTTTGCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013506.1-108s1c1
Sequence:CCGGCGAGAGCAACTGGAATGAAATCTCGAGATTTCATTCCAGTTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013506.1-232s1c1
Sequence:CCGGCCTTGTATTAAAGGGTATGATCTCGAGATCATACCCTTTAATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013506.1-424s1c1
Sequence:CCGGGCAACTTGTCATGCTTGCATTCTCGAGAATGCAAGCATGACAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013506
VALIDATED
EIF4A2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4A2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-1037s21c1
Sequence:CCGGTTGACCCTTGAAGGAATTAAACTCGAGTTTAATTCCTTCAAGGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-676s21c1
Sequence:CCGGTTTGGCTCTTGGAGATTATATCTCGAGATATAATCTCCAAGAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-796s21c1
Sequence:CCGGGAGAGTGTTTGATATGCTAAACTCGAGTTTAGCATATCAAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-486s21c1
Sequence:CCGGCTATTCAGCAAAGAGCTATTACTCGAGTAATAGCTCTTTGCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013506.2-723s21c1
Sequence:CCGGGAGGAACAAATGTTCGAAATGCTCGAGCATTTCGAACATTTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013506.1-1638s1c1
Sequence:CCGGGCCTTTATTGTGTTTGTCATTCTCGAGAATGACAAACACAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013506.1-209s1c1
Sequence:CCGGCTATTCAGCAAAGAGCTATTACTCGAGTAATAGCTCTTTGCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013506.1-108s1c1
Sequence:CCGGCGAGAGCAACTGGAATGAAATCTCGAGATTTCATTCCAGTTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013506.1-232s1c1
Sequence:CCGGCCTTGTATTAAAGGGTATGATCTCGAGATCATACCCTTTAATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013506.1-424s1c1
Sequence:CCGGGCAACTTGTCATGCTTGCATTCTCGAGAATGCAAGCATGACAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013506
VALIDATED
EIF4A2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4A2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-1037s21c1
Sequence:CCGGTTGACCCTTGAAGGAATTAAACTCGAGTTTAATTCCTTCAAGGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-676s21c1
Sequence:CCGGTTTGGCTCTTGGAGATTATATCTCGAGATATAATCTCCAAGAGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-796s21c1
Sequence:CCGGGAGAGTGTTTGATATGCTAAACTCGAGTTTAGCATATCAAACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013506.2-486s21c1
Sequence:CCGGCTATTCAGCAAAGAGCTATTACTCGAGTAATAGCTCTTTGCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013506.2-723s21c1
Sequence:CCGGGAGGAACAAATGTTCGAAATGCTCGAGCATTTCGAACATTTGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013506.1-1638s1c1
Sequence:CCGGGCCTTTATTGTGTTTGTCATTCTCGAGAATGACAAACACAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013506.1-209s1c1
Sequence:CCGGCTATTCAGCAAAGAGCTATTACTCGAGTAATAGCTCTTTGCTGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013506.1-108s1c1
Sequence:CCGGCGAGAGCAACTGGAATGAAATCTCGAGATTTCATTCCAGTTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013506.1-232s1c1
Sequence:CCGGCCTTGTATTAAAGGGTATGATCTCGAGATCATACCCTTTAATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013506.1-424s1c1
Sequence:CCGGGCAACTTGTCATGCTTGCATTCTCGAGAATGCAAGCATGACAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks