EMAIL THIS PAGE TO A FRIEND

EIF4A3

eukaryotic translation initiation factor 4A3

33 Gene Product Result for
Synonyms: DDX48 NMP265 NUK34 eIF4AIII
UniProtKB ID: P38919, Q15033, Q6IBQ2, Q96A18
Gene ID:
Human(9775) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a nuclear matrix protein. Its amino acid sequence is highly similar to the amino acid sequences of the translation initiation factors eIF4AI and eIF4AII, two other members of the DEAD box protein family. [provided by RefSeq, Jul 2008]
Mouse(192170) eukaryotic translation initiation factor 4A3
Rat(688288) eukaryotic translation initiation factor 4A3
Zebrafish(394053) eukaryotic translation initiation factor 4A, isoform 3
cow(515145) eukaryotic translation initiation factor 4A3
Horse(100056586) eukaryotic translation initiation factor 4A3
domestic cat(101094465) eukaryotic translation initiation factor 4A3
dog(475922) eukaryotic translation initiation factor 4A3
chicken(416704) eukaryotic translation initiation factor 4A3
sheep(101121437) eukaryotic translation initiation factor 4A3
domestic guinea pig(100728310) eukaryotic translation initiation factor 4A3
naked mole-rat(101719673) eukaryotic translation initiation factor 4A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36422 Anti-DDX48 antibody produced in rabbit IgG fraction of antiserum rat, mouse, Caenorhabditis elegans, zebrafish, canine, human, horse, bovine, guinea pig
western blot pricing
HPA021878 Anti-EIF4A3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305264 ANTI-EIF4A3(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014740 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025941 MISSION® esiRNA esiRNA human EIF4A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014740 siRNAs that have been validated in the lab human pricing
NM_001100158 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014740 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114536 validated 1385
2 SASI_Hs01_00114537 predicted 1350
3 SASI_Hs01_00114538 predicted 370
4 SASI_Hs01_00114539 predicted 1240
5 SASI_Hs02_00346200 predicted 1245
6 SASI_Hs01_00114540 predicted 900
7 SASI_Hs01_00114541 predicted 763
8 SASI_Hs01_00114542 predicted 862
9 SASI_Hs01_00114543 predicted 465
10 SASI_Hs01_00114544 predicted 1217
11 SASI_Hs01_00114545 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209794 predicted 268
2 SASI_Rn02_00209795 predicted 1260
3 SASI_Rn02_00209796 predicted 1241
4 SASI_Rn02_00209797 predicted 604
5 SASI_Rn02_00209798 predicted 752
6 SASI_Rn02_00209799 predicted 827
7 SASI_Rn02_00209800 predicted 392
8 SASI_Rn02_00209801 predicted 483
9 SASI_Rn02_00209802 predicted 951
10 SASI_Rn02_00209803 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138669
VALIDATED
EIF4A3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4A3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-245s1c1
Sequence:CCGGGCGTGCTATCAAGCAGATAATCTCGAGATTATCTGCTTGATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-1307s1c1
Sequence:CCGGCCTGTTTGGAAACGGAAGCTTCTCGAGAAGCTTCCGTTTCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-1109s1c1
Sequence:CCGGGCCCAACAACAGAGAACTGTACTCGAGTACAGTTCTCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-982s1c1
Sequence:CCGGCCCAGAAAGAACGAGAGTCTACTCGAGTAGACTCTCGTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-612s1c1
Sequence:CCGGGCTGATGAAATGTTGAACAAACTCGAGTTTGTTCAACATTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-245s21c1
Sequence:CCGGGCGTGCTATCAAGCAGATAATCTCGAGATTATCTGCTTGATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-1109s21c1
Sequence:CCGGGCCCAACAACAGAGAACTGTACTCGAGTACAGTTCTCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-833s21c1
Sequence:CCGGATGGAAATTTGATACTCTATGCTCGAGCATAGAGTATCAAATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-1307s21c1
Sequence:CCGGCCTGTTTGGAAACGGAAGCTTCTCGAGAAGCTTCCGTTTCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-634s21c1
Sequence:CCGGGTTTCAAGGAGCAGATCTATGCTCGAGCATAGATCTGCTCCTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138669
VALIDATED
EIF4A3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4A3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-245s1c1
Sequence:CCGGGCGTGCTATCAAGCAGATAATCTCGAGATTATCTGCTTGATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-1307s1c1
Sequence:CCGGCCTGTTTGGAAACGGAAGCTTCTCGAGAAGCTTCCGTTTCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-1109s1c1
Sequence:CCGGGCCCAACAACAGAGAACTGTACTCGAGTACAGTTCTCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-982s1c1
Sequence:CCGGCCCAGAAAGAACGAGAGTCTACTCGAGTAGACTCTCGTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-612s1c1
Sequence:CCGGGCTGATGAAATGTTGAACAAACTCGAGTTTGTTCAACATTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-245s21c1
Sequence:CCGGGCGTGCTATCAAGCAGATAATCTCGAGATTATCTGCTTGATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-1109s21c1
Sequence:CCGGGCCCAACAACAGAGAACTGTACTCGAGTACAGTTCTCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-833s21c1
Sequence:CCGGATGGAAATTTGATACTCTATGCTCGAGCATAGAGTATCAAATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-1307s21c1
Sequence:CCGGCCTGTTTGGAAACGGAAGCTTCTCGAGAAGCTTCCGTTTCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-634s21c1
Sequence:CCGGGTTTCAAGGAGCAGATCTATGCTCGAGCATAGATCTGCTCCTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138669
VALIDATED
EIF4A3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4A3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-245s1c1
Sequence:CCGGGCGTGCTATCAAGCAGATAATCTCGAGATTATCTGCTTGATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-1307s1c1
Sequence:CCGGCCTGTTTGGAAACGGAAGCTTCTCGAGAAGCTTCCGTTTCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-1109s1c1
Sequence:CCGGGCCCAACAACAGAGAACTGTACTCGAGTACAGTTCTCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-982s1c1
Sequence:CCGGCCCAGAAAGAACGAGAGTCTACTCGAGTAGACTCTCGTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138669.1-612s1c1
Sequence:CCGGGCTGATGAAATGTTGAACAAACTCGAGTTTGTTCAACATTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-245s21c1
Sequence:CCGGGCGTGCTATCAAGCAGATAATCTCGAGATTATCTGCTTGATAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-1109s21c1
Sequence:CCGGGCCCAACAACAGAGAACTGTACTCGAGTACAGTTCTCTGTTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-833s21c1
Sequence:CCGGATGGAAATTTGATACTCTATGCTCGAGCATAGAGTATCAAATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-1307s21c1
Sequence:CCGGCCTGTTTGGAAACGGAAGCTTCTCGAGAAGCTTCCGTTTCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138669.1-634s21c1
Sequence:CCGGGTTTCAAGGAGCAGATCTATGCTCGAGCATAGATCTGCTCCTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014740
VALIDATED
EIF4A3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4A3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-1163s1c1
Sequence:CCGGCGAGTGCTTATTTCTACAGATCTCGAGATCTGTAGAAATAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-890s1c1
Sequence:CCGGCGCATCTTGGTGAAACGTGATCTCGAGATCACGTTTCACCAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-560s1c1
Sequence:CCGGGCTCTCGGTGACTACATGAATCTCGAGATTCATGTAGTCACCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-1357s1c1
Sequence:CCGGGCAGTACTATTCCACTCAGATCTCGAGATCTGAGTGGAATAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-380s1c1
Sequence:CCGGGCAATCAAGCAGATCATCAAACTCGAGTTTGATGATCTGCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-560s21c1
Sequence:CCGGGCTCTCGGTGACTACATGAATCTCGAGATTCATGTAGTCACCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-1508s21c1
Sequence:CCGGATGGACTTTCTTCTCATAAATCTCGAGATTTATGAGAAGAAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-1357s21c1
Sequence:CCGGGCAGTACTATTCCACTCAGATCTCGAGATCTGAGTGGAATAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-890s21c1
Sequence:CCGGCGCATCTTGGTGAAACGTGATCTCGAGATCACGTTTCACCAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-380s21c1
Sequence:CCGGGCAATCAAGCAGATCATCAAACTCGAGTTTGATGATCTGCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014740
VALIDATED
EIF4A3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4A3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-1163s1c1
Sequence:CCGGCGAGTGCTTATTTCTACAGATCTCGAGATCTGTAGAAATAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-890s1c1
Sequence:CCGGCGCATCTTGGTGAAACGTGATCTCGAGATCACGTTTCACCAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-560s1c1
Sequence:CCGGGCTCTCGGTGACTACATGAATCTCGAGATTCATGTAGTCACCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-1357s1c1
Sequence:CCGGGCAGTACTATTCCACTCAGATCTCGAGATCTGAGTGGAATAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-380s1c1
Sequence:CCGGGCAATCAAGCAGATCATCAAACTCGAGTTTGATGATCTGCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-560s21c1
Sequence:CCGGGCTCTCGGTGACTACATGAATCTCGAGATTCATGTAGTCACCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-1508s21c1
Sequence:CCGGATGGACTTTCTTCTCATAAATCTCGAGATTTATGAGAAGAAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-1357s21c1
Sequence:CCGGGCAGTACTATTCCACTCAGATCTCGAGATCTGAGTGGAATAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-890s21c1
Sequence:CCGGCGCATCTTGGTGAAACGTGATCTCGAGATCACGTTTCACCAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-380s21c1
Sequence:CCGGGCAATCAAGCAGATCATCAAACTCGAGTTTGATGATCTGCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014740
VALIDATED
EIF4A3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4A3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-1163s1c1
Sequence:CCGGCGAGTGCTTATTTCTACAGATCTCGAGATCTGTAGAAATAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-890s1c1
Sequence:CCGGCGCATCTTGGTGAAACGTGATCTCGAGATCACGTTTCACCAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-560s1c1
Sequence:CCGGGCTCTCGGTGACTACATGAATCTCGAGATTCATGTAGTCACCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-1357s1c1
Sequence:CCGGGCAGTACTATTCCACTCAGATCTCGAGATCTGAGTGGAATAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014740.2-380s1c1
Sequence:CCGGGCAATCAAGCAGATCATCAAACTCGAGTTTGATGATCTGCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-560s21c1
Sequence:CCGGGCTCTCGGTGACTACATGAATCTCGAGATTCATGTAGTCACCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-1508s21c1
Sequence:CCGGATGGACTTTCTTCTCATAAATCTCGAGATTTATGAGAAGAAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-1357s21c1
Sequence:CCGGGCAGTACTATTCCACTCAGATCTCGAGATCTGAGTGGAATAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-890s21c1
Sequence:CCGGCGCATCTTGGTGAAACGTGATCTCGAGATCACGTTTCACCAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014740.2-380s21c1
Sequence:CCGGGCAATCAAGCAGATCATCAAACTCGAGTTTGATGATCTGCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks