EMAIL THIS PAGE TO A FRIEND

EIF4B

eukaryotic translation initiation factor 4B

Synonyms: EIF-4B PRO1843
UniProtKB ID: P23588, Q4G0E3, Q53HQ2, Q6GPH5, Q6IB46, Q8WYK5
Gene ID:
Mouse(75705) eukaryotic translation initiation factor 4B
Rat(300253) eukaryotic translation initiation factor 4B
chicken(100858349) eukaryotic translation initiation factor 4B
dog(477600) eukaryotic translation initiation factor 4B
domestic cat(101081817) eukaryotic translation initiation factor 4B
cow(505850) eukaryotic translation initiation factor 4B
Horse(100061920) eukaryotic translation initiation factor 4B
naked mole-rat(101698505) eukaryotic translation initiation factor 4B
domestic guinea pig(100735681) eukaryotic translation initiation factor 4B
sheep(101107685) eukaryotic translation initiation factor 4B
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300581 Anti-EIF4B (Ab-422) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry pricing
SAB1405748 Anti-EIF4B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV40359 Anti-EIF4B antibody produced in rabbit IgG fraction of antiserum human, horse, bovine, rat, guinea pig, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2105432 Anti-EIF4B antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, rabbit
western blot pricing
HPA046164 Anti-EIF4B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501595 Anti-EIF4B antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
HPA039072 Anti-EIF4B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4300267 Anti-phospho-EIF4B (pSer422) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB5300108 Monoclonal Anti-EIF4B antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, flow cytometry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001417 Rosetta Predictions human pricing
NM_001008324 Rosetta Predictions rat pricing
NM_145625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121466 predicted 1558
2 SASI_Hs02_00331818 predicted 2086
3 SASI_Hs01_00121467 predicted 368
4 SASI_Hs01_00121468 predicted 1250
5 SASI_Hs01_00121471 predicted 868
6 SASI_Hs02_00331819 predicted 1976
7 SASI_Hs02_00331820 predicted 2017
8 SASI_Hs01_00121472 predicted 1094
9 SASI_Hs01_00121473 predicted 717
10 SASI_Hs01_00121474 predicted 1641
11 SASI_Hs01_00121469 predicted 1074
12 SASI_Hs01_00121470 predicted 1404
13 SASI_Hs01_00121475 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031336 predicted 954
2 SASI_Rn01_00031337 predicted 1253
3 SASI_Rn01_00031338 predicted 1720
4 SASI_Rn01_00031339 predicted 1312
5 SASI_Rn01_00031340 predicted 405
6 SASI_Rn01_00031341 predicted 337
7 SASI_Rn01_00031342 predicted 802
8 SASI_Rn02_00199062 predicted 1477
9 SASI_Rn02_00199063 predicted 520
10 SASI_Rn01_00031344 predicted 1395
11 SASI_Rn01_00031343 predicted 1614
12 SASI_Rn01_00031345 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341199 predicted 838
2 SASI_Mm02_00341200 predicted 808
3 SASI_Mm02_00341201 predicted 672
4 SASI_Mm01_00138259 predicted 1636
5 SASI_Mm01_00138260 predicted 1119
6 SASI_Mm02_00341202 predicted 962
7 SASI_Mm02_00341203 predicted 684
8 SASI_Mm02_00341204 predicted 1556
9 SASI_Mm02_00341205 predicted 1751
10 SASI_Mm01_00138261 predicted 1408
11 SASI_Mm01_00138262 predicted 1283
12 SASI_Mm01_00138263 predicted 915
13 SASI_Mm01_00138264 predicted 1286
14 SASI_Mm01_00138265 predicted 938
15 SASI_Mm01_00138266 predicted 2212
16 SASI_Mm01_00138267 predicted 2153
17 SASI_Mm01_00138268 predicted 2185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145625
VALIDATED
EIF4B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4B
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-1936s21c1
Sequence:CCGGGTTCAGCTCTGCAAGCAAGTACTCGAGTACTTGCTTGCAGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-1122s21c1
Sequence:CCGGACTACTCTCGGGATGATTATACTCGAGTATAATCATCCCGAGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-219s21c1
Sequence:CCGGCCATCTCCCTAACGGACTTTCCTCGAGGAAAGTCCGTTAGGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-842s21c1
Sequence:CCGGGACAAGTATCGAGATCGTTACCTCGAGGTAACGATCTCGATACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-870s21c1
Sequence:CCGGACCGGTATCGGGATGGGTATACTCGAGTATACCCATCCCGATACCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145625.3-2369s21c1
Sequence:CCGGGTGAGATTTCTACTTTCTAATCTCGAGATTAGAAAGTAGAAATCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-487s21c1
Sequence:CCGGGCCCTATGATGTGACAGAAGACTCGAGTCTTCTGTCACATCATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-554s21c1
Sequence:CCGGTTACCACGGGAACCCAGCAATCTCGAGATTGCTGGGTTCCCGTGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-1702s1c1
Sequence:CCGGGCCAAAGAAACCTGAGGAGAACTCGAGTTCTCCTCAGGTTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-863s1c1
Sequence:CCGGGACCGCTATGAAGACCGCTATCTCGAGATAGCGGTCTTCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-1732s1c1
Sequence:CCGGCAAGTTCAGCTCTGCAAGCAACTCGAGTTGCTTGCAGAGCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145625.1-1355s1c1
Sequence:CCGGCCAACCTCTAAGCCTCCTAAACTCGAGTTTAGGAGGCTTAGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145625
VALIDATED
EIF4B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4B
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-1936s21c1
Sequence:CCGGGTTCAGCTCTGCAAGCAAGTACTCGAGTACTTGCTTGCAGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-1122s21c1
Sequence:CCGGACTACTCTCGGGATGATTATACTCGAGTATAATCATCCCGAGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-219s21c1
Sequence:CCGGCCATCTCCCTAACGGACTTTCCTCGAGGAAAGTCCGTTAGGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-842s21c1
Sequence:CCGGGACAAGTATCGAGATCGTTACCTCGAGGTAACGATCTCGATACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-870s21c1
Sequence:CCGGACCGGTATCGGGATGGGTATACTCGAGTATACCCATCCCGATACCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145625.3-2369s21c1
Sequence:CCGGGTGAGATTTCTACTTTCTAATCTCGAGATTAGAAAGTAGAAATCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-487s21c1
Sequence:CCGGGCCCTATGATGTGACAGAAGACTCGAGTCTTCTGTCACATCATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-554s21c1
Sequence:CCGGTTACCACGGGAACCCAGCAATCTCGAGATTGCTGGGTTCCCGTGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-1702s1c1
Sequence:CCGGGCCAAAGAAACCTGAGGAGAACTCGAGTTCTCCTCAGGTTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-863s1c1
Sequence:CCGGGACCGCTATGAAGACCGCTATCTCGAGATAGCGGTCTTCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-1732s1c1
Sequence:CCGGCAAGTTCAGCTCTGCAAGCAACTCGAGTTGCTTGCAGAGCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145625.1-1355s1c1
Sequence:CCGGCCAACCTCTAAGCCTCCTAAACTCGAGTTTAGGAGGCTTAGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145625
VALIDATED
EIF4B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4B
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-1936s21c1
Sequence:CCGGGTTCAGCTCTGCAAGCAAGTACTCGAGTACTTGCTTGCAGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-1122s21c1
Sequence:CCGGACTACTCTCGGGATGATTATACTCGAGTATAATCATCCCGAGAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-219s21c1
Sequence:CCGGCCATCTCCCTAACGGACTTTCCTCGAGGAAAGTCCGTTAGGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-842s21c1
Sequence:CCGGGACAAGTATCGAGATCGTTACCTCGAGGTAACGATCTCGATACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-870s21c1
Sequence:CCGGACCGGTATCGGGATGGGTATACTCGAGTATACCCATCCCGATACCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145625.3-2369s21c1
Sequence:CCGGGTGAGATTTCTACTTTCTAATCTCGAGATTAGAAAGTAGAAATCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-487s21c1
Sequence:CCGGGCCCTATGATGTGACAGAAGACTCGAGTCTTCTGTCACATCATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145625.3-554s21c1
Sequence:CCGGTTACCACGGGAACCCAGCAATCTCGAGATTGCTGGGTTCCCGTGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-1702s1c1
Sequence:CCGGGCCAAAGAAACCTGAGGAGAACTCGAGTTCTCCTCAGGTTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-863s1c1
Sequence:CCGGGACCGCTATGAAGACCGCTATCTCGAGATAGCGGTCTTCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145625.1-1732s1c1
Sequence:CCGGCAAGTTCAGCTCTGCAAGCAACTCGAGTTGCTTGCAGAGCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145625.1-1355s1c1
Sequence:CCGGCCAACCTCTAAGCCTCCTAAACTCGAGTTTAGGAGGCTTAGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001417
VALIDATED
EIF4B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-870s21c1
Sequence:CCGGGACAAGTATCGAGATCGTTATCTCGAGATAACGATCTCGATACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-943s21c1
Sequence:CCGGGCCGGGATATGGATCGATATGCTCGAGCATATCGATCCATATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-524s21c1
Sequence:CCGGTGTTACAGAAGAGTCAATTAACTCGAGTTAATTGACTCTTCTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-1092s21c1
Sequence:CCGGGACCGCTATGAAGACCGATATCTCGAGATATCGGTCTTCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-2356s21c1
Sequence:CCGGTGGTAATGACAGTGATATAATCTCGAGATTATATCACTGTCATTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-968s1c1
Sequence:CCGGCGGGATGATTATAGGCGTGATCTCGAGATCACGCCTATAATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-323s1c1
Sequence:CCGGCTACCCTATGATGTTACAGAACTCGAGTTCTGTAACATCATAGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-1394s1c1
Sequence:CCGGCCAACTTCTAAACCTCCCAAACTCGAGTTTGGGAGGTTTAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001417.2-3284s1c1
Sequence:CCGGGCGGAGAAACACCTTGATCTTCTCGAGAAGATCAAGGTGTTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-570s1c1
Sequence:CCGGGCCGTGATAGAAATCGGGATTCTCGAGAATCCCGATTTCTATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001417
VALIDATED
EIF4B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-870s21c1
Sequence:CCGGGACAAGTATCGAGATCGTTATCTCGAGATAACGATCTCGATACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-943s21c1
Sequence:CCGGGCCGGGATATGGATCGATATGCTCGAGCATATCGATCCATATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-524s21c1
Sequence:CCGGTGTTACAGAAGAGTCAATTAACTCGAGTTAATTGACTCTTCTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-1092s21c1
Sequence:CCGGGACCGCTATGAAGACCGATATCTCGAGATATCGGTCTTCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-2356s21c1
Sequence:CCGGTGGTAATGACAGTGATATAATCTCGAGATTATATCACTGTCATTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-968s1c1
Sequence:CCGGCGGGATGATTATAGGCGTGATCTCGAGATCACGCCTATAATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-323s1c1
Sequence:CCGGCTACCCTATGATGTTACAGAACTCGAGTTCTGTAACATCATAGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-1394s1c1
Sequence:CCGGCCAACTTCTAAACCTCCCAAACTCGAGTTTGGGAGGTTTAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001417.2-3284s1c1
Sequence:CCGGGCGGAGAAACACCTTGATCTTCTCGAGAAGATCAAGGTGTTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-570s1c1
Sequence:CCGGGCCGTGATAGAAATCGGGATTCTCGAGAATCCCGATTTCTATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001417
VALIDATED
EIF4B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-870s21c1
Sequence:CCGGGACAAGTATCGAGATCGTTATCTCGAGATAACGATCTCGATACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-943s21c1
Sequence:CCGGGCCGGGATATGGATCGATATGCTCGAGCATATCGATCCATATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-524s21c1
Sequence:CCGGTGTTACAGAAGAGTCAATTAACTCGAGTTAATTGACTCTTCTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-1092s21c1
Sequence:CCGGGACCGCTATGAAGACCGATATCTCGAGATATCGGTCTTCATAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001417.4-2356s21c1
Sequence:CCGGTGGTAATGACAGTGATATAATCTCGAGATTATATCACTGTCATTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-968s1c1
Sequence:CCGGCGGGATGATTATAGGCGTGATCTCGAGATCACGCCTATAATCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-323s1c1
Sequence:CCGGCTACCCTATGATGTTACAGAACTCGAGTTCTGTAACATCATAGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-1394s1c1
Sequence:CCGGCCAACTTCTAAACCTCCCAAACTCGAGTTTGGGAGGTTTAGAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001417.2-3284s1c1
Sequence:CCGGGCGGAGAAACACCTTGATCTTCTCGAGAAGATCAAGGTGTTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001417.2-570s1c1
Sequence:CCGGGCCGTGATAGAAATCGGGATTCTCGAGAATCCCGATTTCTATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks