EMAIL THIS PAGE TO A FRIEND

EIF4E1B

eukaryotic translation initiation factor 4E family member 1B

78 Gene Product Result for
UniProtKB ID: A6NMX2
Gene ID:
Mouse(218268) eukaryotic translation initiation factor 4E family member 1B
Rat(686104) eukaryotic translation initiation factor 4E family member 1B
sheep(101106260) eukaryotic translation initiation factor 4E family member 1B
domestic guinea pig(100724587) eukaryotic translation initiation factor 4E family member 1B
naked mole-rat(101715494) eukaryotic translation initiation factor 4E family member 1B
Zebrafish(30738) eukaryotic translation initiation factor 4e 1b
dog(489099) eukaryotic translation initiation factor 4E family member 1B
cow(614570) eukaryotic translation initiation factor 4E family member 1B
domestic cat(101088140) eukaryotic translation initiation factor 4E family member 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099408 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052721 MISSION® esiRNA esiRNA human EIF4E1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099408 Rosetta Predictions human pricing
XM_171094 Rosetta Predictions human pricing
XM_927854 Rosetta Predictions human pricing
XM_932348 Rosetta Predictions human pricing
XM_001066554 Rosetta Predictions rat pricing
NM_001033269 Rosetta Predictions mouse pricing
NM_001039683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320609 predicted 1735
2 SASI_Hs02_00320610 predicted 860
3 SASI_Hs02_00320611 predicted 1183
4 SASI_Hs02_00320612 predicted 1583
5 SASI_Hs02_00320613 predicted 1647
6 SASI_Hs02_00320614 predicted 1415
7 SASI_Hs02_00320615 predicted 1616
8 SASI_Hs02_00320616 predicted 1493
9 SASI_Hs02_00320617 predicted 1746
10 SASI_Hs02_00320618 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_171094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291850 predicted 791
2 SASI_Hs01_00291851 predicted 679
3 SASI_Hs01_00291852 predicted 518
4 SASI_Hs01_00291853 predicted 707
5 SASI_Hs01_00291854 predicted 670
6 SASI_Hs01_00291855 predicted 577
7 SASI_Hs01_00291856 predicted 528
8 SASI_Hs01_00291857 predicted 521
9 SASI_Hs01_00291858 predicted 515
10 SASI_Hs01_00291859 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251234 predicted 204
2 SASI_Hs01_00251235 predicted 199
3 SASI_Hs01_00251236 predicted 255
4 SASI_Hs01_00251237 predicted 421
5 SASI_Hs01_00251238 predicted 328
6 SASI_Hs01_00251239 predicted 220
7 SASI_Hs01_00251240 predicted 209
8 SASI_Hs01_00251241 predicted 295
9 SASI_Hs01_00251242 predicted 421
10 SASI_Hs01_00251243 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264381 predicted 417
2 SASI_Hs01_00264382 predicted 973
3 SASI_Hs01_00264383 predicted 2550
4 SASI_Hs01_00264384 predicted 2433
5 SASI_Hs01_00264385 predicted 2284
6 SASI_Hs01_00264386 predicted 2469
7 SASI_Hs01_00264387 predicted 1291
8 SASI_Hs01_00264388 predicted 2237
9 SASI_Hs01_00264389 predicted 1856
10 SASI_Hs01_00264390 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317937 predicted 265
2 SASI_Rn02_00317938 predicted 299
3 SASI_Rn02_00317939 predicted 368
4 SASI_Rn02_00317940 predicted 374
5 SASI_Rn02_00317941 predicted 347
6 SASI_Rn02_00317942 predicted 435
7 SASI_Rn02_00317943 predicted 380
8 SASI_Rn02_00317944 predicted 345
9 SASI_Rn02_00317945 predicted 294
10 SASI_Rn02_00317946 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154993 predicted 223
2 SASI_Mm01_00154994 predicted 254
3 SASI_Mm01_00154995 predicted 240
4 SASI_Mm01_00154996 predicted 240
5 SASI_Mm01_00154997 predicted 355
6 SASI_Mm01_00154998 predicted 212
7 SASI_Mm01_00154999 predicted 251
8 SASI_Mm01_00155000 predicted 362
9 SASI_Mm01_00155001 predicted 235
10 SASI_Mm01_00155002 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133521 predicted 206
2 SASI_Mm01_00133522 predicted 232
3 SASI_Mm01_00133523 predicted 228
4 SASI_Mm01_00133524 predicted 224
5 SASI_Mm01_00133525 predicted 335
6 SASI_Mm01_00133526 predicted 195
7 SASI_Mm01_00133527 predicted 233
8 SASI_Mm01_00133528 predicted 346
9 SASI_Mm01_00133529 predicted 217
10 SASI_Mm01_00133530 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033269
EIF4E1B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E family member 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-362s21c1
Sequence:CCGGTGCAGCTAGTCACCAAGTTTACTCGAGTAAACTTGGTGACTAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-710s21c1
Sequence:CCGGTGATGCAGATCGGGCAAATATCTCGAGATATTTGCCCGATCTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033269.2-1333s21c1
Sequence:CCGGTGAGCTTAAAGGCTGATTATGCTCGAGCATAATCAGCCTTTAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-749s21c1
Sequence:CCGGTCTCTACGAAGACCATCATTGCTCGAGCAATGATGGTCTTCGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-653s21c1
Sequence:CCGGGCACGAAGAGGGACAAGATTGCTCGAGCAATCTTGTCCCTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033269
EIF4E1B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E family member 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-362s21c1
Sequence:CCGGTGCAGCTAGTCACCAAGTTTACTCGAGTAAACTTGGTGACTAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-710s21c1
Sequence:CCGGTGATGCAGATCGGGCAAATATCTCGAGATATTTGCCCGATCTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033269.2-1333s21c1
Sequence:CCGGTGAGCTTAAAGGCTGATTATGCTCGAGCATAATCAGCCTTTAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-749s21c1
Sequence:CCGGTCTCTACGAAGACCATCATTGCTCGAGCAATGATGGTCTTCGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-653s21c1
Sequence:CCGGGCACGAAGAGGGACAAGATTGCTCGAGCAATCTTGTCCCTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033269
EIF4E1B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E family member 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-362s21c1
Sequence:CCGGTGCAGCTAGTCACCAAGTTTACTCGAGTAAACTTGGTGACTAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-710s21c1
Sequence:CCGGTGATGCAGATCGGGCAAATATCTCGAGATATTTGCCCGATCTGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033269.2-1333s21c1
Sequence:CCGGTGAGCTTAAAGGCTGATTATGCTCGAGCATAATCAGCCTTTAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-749s21c1
Sequence:CCGGTCTCTACGAAGACCATCATTGCTCGAGCAATGATGGTCTTCGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033269.2-653s21c1
Sequence:CCGGGCACGAAGAGGGACAAGATTGCTCGAGCAATCTTGTCCCTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099408
EIF4E1B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E family member 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-1285s21c1
Sequence:CCGGCCCTAGCCAAGAACAAGTTTGCTCGAGCAAACTTGTTCTTGGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099408.1-1594s21c1
Sequence:CCGGCTCTATGGTAGGCGGAGAAACCTCGAGGTTTCTCCGCCTACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-963s21c1
Sequence:CCGGTGGGAGGACAGCAGGAATAAACTCGAGTTTATTCCTGCTGTCCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-690s21c1
Sequence:CCGGCCAAACTCTCCCAGGACTTTGCTCGAGCAAAGTCCTGGGAGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-1192s21c1
Sequence:CCGGACGTTGGGCGTGTATACAAAGCTCGAGCTTTGTATACACGCCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099408
EIF4E1B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E family member 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-1285s21c1
Sequence:CCGGCCCTAGCCAAGAACAAGTTTGCTCGAGCAAACTTGTTCTTGGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099408.1-1594s21c1
Sequence:CCGGCTCTATGGTAGGCGGAGAAACCTCGAGGTTTCTCCGCCTACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-963s21c1
Sequence:CCGGTGGGAGGACAGCAGGAATAAACTCGAGTTTATTCCTGCTGTCCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-690s21c1
Sequence:CCGGCCAAACTCTCCCAGGACTTTGCTCGAGCAAAGTCCTGGGAGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-1192s21c1
Sequence:CCGGACGTTGGGCGTGTATACAAAGCTCGAGCTTTGTATACACGCCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099408
EIF4E1B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E family member 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-1285s21c1
Sequence:CCGGCCCTAGCCAAGAACAAGTTTGCTCGAGCAAACTTGTTCTTGGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099408.1-1594s21c1
Sequence:CCGGCTCTATGGTAGGCGGAGAAACCTCGAGGTTTCTCCGCCTACCATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-963s21c1
Sequence:CCGGTGGGAGGACAGCAGGAATAAACTCGAGTTTATTCCTGCTGTCCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-690s21c1
Sequence:CCGGCCAAACTCTCCCAGGACTTTGCTCGAGCAAAGTCCTGGGAGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099408.1-1192s21c1
Sequence:CCGGACGTTGGGCGTGTATACAAAGCTCGAGCTTTGTATACACGCCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks