EMAIL THIS PAGE TO A FRIEND

EIF4E2

eukaryotic translation initiation factor 4E family member 2

217 Gene Product Result for
Synonyms: 4E-LP 4EHP EIF4EL3 IF4e
UniProtKB ID: O60573, O75349
Gene ID:
Mouse(26987) eukaryotic translation initiation factor 4E member 2
Rat(363275) eukaryotic translation initiation factor 4E family member 2
Zebrafish(541523) eukaryotic translation initiation factor 4E family member 2
cow(519920) eukaryotic translation initiation factor 4E family member 2
domestic cat(101099142) eukaryotic translation initiation factor 4E family member 2
dog(610238) eukaryotic translation initiation factor 4E family member 2
chicken(424941) eukaryotic translation initiation factor 4E family member 2
naked mole-rat(101706987) eukaryotic translation initiation factor 4E family member 2
domestic guinea pig(100733247) eukaryotic translation initiation factor 4E family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004846 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004846 Rosetta Predictions human pricing
NM_001108808 Rosetta Predictions rat pricing
NM_001039169 Rosetta Predictions mouse pricing
NM_001039170 Rosetta Predictions mouse pricing
NM_023314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062918 predicted 668
2 SASI_Hs01_00062919 predicted 696
3 SASI_Hs01_00062920 predicted 601
4 SASI_Hs01_00062922 predicted 651
5 SASI_Hs01_00062923 predicted 432
6 SASI_Hs01_00062924 predicted 781
7 SASI_Hs01_00062925 predicted 243
8 SASI_Hs01_00062926 predicted 400
9 SASI_Hs01_00062927 predicted 302
10 SASI_Hs02_00338433 predicted 635
11 SASI_Hs01_00062921 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242275 predicted 673
2 SASI_Rn02_00242276 predicted 738
3 SASI_Rn02_00242277 predicted 737
4 SASI_Rn02_00242278 predicted 736
5 SASI_Rn02_00242279 predicted 807
6 SASI_Rn02_00242280 predicted 840
7 SASI_Rn02_00242281 predicted 817
8 SASI_Rn02_00242282 predicted 595
9 SASI_Rn02_00242283 predicted 660
10 SASI_Rn02_00242284 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135140 predicted 931
2 SASI_Mm01_00135141 predicted 762
3 SASI_Mm01_00135142 predicted 752
4 SASI_Mm01_00135143 predicted 797
5 SASI_Mm02_00289921 predicted 863
6 SASI_Mm01_00135144 predicted 759
7 SASI_Mm01_00135145 predicted 860
8 SASI_Mm01_00135147 predicted 931
9 SASI_Mm01_00135148 predicted 945
10 SASI_Mm01_00135149 predicted 880
11 SASI_Mm01_00135146 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107962 predicted 476
2 SASI_Mm01_00107964 predicted 313
3 SASI_Mm01_00107965 predicted 306
4 SASI_Mm01_00107966 predicted 346
5 SASI_Mm02_00289922 predicted 414
6 SASI_Mm01_00107967 predicted 314
7 SASI_Mm02_00289923 predicted 438
8 SASI_Mm01_00107968 predicted 405
9 SASI_Mm01_00107970 predicted 489
10 SASI_Mm01_00107971 predicted 499
11 SASI_Mm01_00107963 predicted 431
12 SASI_Mm01_00107969 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037123 predicted 475
2 SASI_Mm01_00037125 predicted 308
3 SASI_Mm01_00037126 predicted 304
4 SASI_Mm01_00037127 predicted 351
5 SASI_Mm02_00327043 predicted 413
6 SASI_Mm01_00037128 predicted 306
7 SASI_Mm02_00327044 predicted 438
8 SASI_Mm01_00037129 predicted 405
9 SASI_Mm01_00037131 predicted 482
10 SASI_Mm01_00037132 predicted 491
11 SASI_Mm01_00037124 predicted 426
12 SASI_Mm01_00037130 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023314
VALIDATED
EIF4E2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023314.3-453s21c1
Sequence:CCGGATGTGGGAGGATGATGCAAATCTCGAGATTTGCATCATCCTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-755s21c1
Sequence:CCGGCAATTCAAGCTTTCGAAATACCTCGAGGTATTTCGAAAGCTTGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-702s21c1
Sequence:CCGGCTACCTCCCAACACCATTATGCTCGAGCATAATGGTGTTGGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023314.3-953s21c1
Sequence:CCGGCAGCATTGCTGACCTTATAAACTCGAGTTTATAAGGTCAGCAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-604s21c1
Sequence:CCGGTCCGCTTTCAGGAGGACATTACTCGAGTAATGTCCTCCTGAAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023314.2-1154s1c1
Sequence:CCGGGCTGAGCGTTATCAGTATTATCTCGAGATAATACTGATAACGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-708s1c1
Sequence:CCGGCAACACCATTATGGAATACAACTCGAGTTGTATTCCATAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-152s1c1
Sequence:CCGGGCACACAGAAAGATGGTGAGACTCGAGTCTCACCATCTTTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-703s1c1
Sequence:CCGGCCTCCCAACACCATTATGGAACTCGAGTTCCATAATGGTGTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023314.2-958s1c1
Sequence:CCGGGCTGACCTTATAAAGTGGGAACTCGAGTTCCCACTTTATAAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023314
VALIDATED
EIF4E2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023314.3-453s21c1
Sequence:CCGGATGTGGGAGGATGATGCAAATCTCGAGATTTGCATCATCCTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-755s21c1
Sequence:CCGGCAATTCAAGCTTTCGAAATACCTCGAGGTATTTCGAAAGCTTGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-702s21c1
Sequence:CCGGCTACCTCCCAACACCATTATGCTCGAGCATAATGGTGTTGGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023314.3-953s21c1
Sequence:CCGGCAGCATTGCTGACCTTATAAACTCGAGTTTATAAGGTCAGCAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-604s21c1
Sequence:CCGGTCCGCTTTCAGGAGGACATTACTCGAGTAATGTCCTCCTGAAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023314.2-1154s1c1
Sequence:CCGGGCTGAGCGTTATCAGTATTATCTCGAGATAATACTGATAACGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-708s1c1
Sequence:CCGGCAACACCATTATGGAATACAACTCGAGTTGTATTCCATAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-152s1c1
Sequence:CCGGGCACACAGAAAGATGGTGAGACTCGAGTCTCACCATCTTTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-703s1c1
Sequence:CCGGCCTCCCAACACCATTATGGAACTCGAGTTCCATAATGGTGTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023314.2-958s1c1
Sequence:CCGGGCTGACCTTATAAAGTGGGAACTCGAGTTCCCACTTTATAAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023314
VALIDATED
EIF4E2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023314.3-453s21c1
Sequence:CCGGATGTGGGAGGATGATGCAAATCTCGAGATTTGCATCATCCTCCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-755s21c1
Sequence:CCGGCAATTCAAGCTTTCGAAATACCTCGAGGTATTTCGAAAGCTTGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-702s21c1
Sequence:CCGGCTACCTCCCAACACCATTATGCTCGAGCATAATGGTGTTGGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023314.3-953s21c1
Sequence:CCGGCAGCATTGCTGACCTTATAAACTCGAGTTTATAAGGTCAGCAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023314.3-604s21c1
Sequence:CCGGTCCGCTTTCAGGAGGACATTACTCGAGTAATGTCCTCCTGAAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023314.2-1154s1c1
Sequence:CCGGGCTGAGCGTTATCAGTATTATCTCGAGATAATACTGATAACGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-708s1c1
Sequence:CCGGCAACACCATTATGGAATACAACTCGAGTTGTATTCCATAATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-152s1c1
Sequence:CCGGGCACACAGAAAGATGGTGAGACTCGAGTCTCACCATCTTTCTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023314.2-703s1c1
Sequence:CCGGCCTCCCAACACCATTATGGAACTCGAGTTCCATAATGGTGTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023314.2-958s1c1
Sequence:CCGGGCTGACCTTATAAAGTGGGAACTCGAGTTCCCACTTTATAAGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004846
VALIDATED
EIF4E2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E family member 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-176s21c1
Sequence:CCGGCGGAACGAGACAAGAATCAGACTCGAGTCTGATTCTTGTCTCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-121s21c1
Sequence:CCGGGACCATGATCAGAATGAAGAACTCGAGTTCTTCATTCTGATCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004846.2-417s21c1
Sequence:CCGGCCATCTCTTCAAAGAAGGAATCTCGAGATTCCTTCTTTGAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-627s21c1
Sequence:CCGGGAATAAGACTGCCAGTGACCACTCGAGTGGTCACTGGCAGTCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004846.2-598s21c1
Sequence:CCGGCGCTTTCAGGAAGACATTATTCTCGAGAATAATGTCTTCCTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-117s1c1
Sequence:CCGGCGAGACAAGAATCAGAGCAGTCTCGAGACTGCTCTGATTCTTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-112s1c1
Sequence:CCGGCGGAACGAGACAAGAATCAGACTCGAGTCTGATTCTTGTCTCGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-57s1c1
Sequence:CCGGGACCATGATCAGAATGAAGAACTCGAGTTCTTCATTCTGATCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-238s1c1
Sequence:CCGGCACAGAGCTATGAACAGAATACTCGAGTATTCTGTTCATAGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004846.1-353s1c1
Sequence:CCGGCCATCTCTTCAAAGAAGGAATCTCGAGATTCCTTCTTTGAAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-534s1c1
Sequence:CCGGCGCTTTCAGGAAGACATTATTCTCGAGAATAATGTCTTCCTGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004846.1-179s1c1
Sequence:CCGGCCTGCAGTACAACTACACTTTCTCGAGAAAGTGTAGTTGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004846.1-83s1c1
Sequence:CCGGCACACAGAAAGATGGTGAGAACTCGAGTTCTCACCATCTTTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-563s1c1
Sequence:CCGGGAATAAGACTGCCAGTGACCACTCGAGTGGTCACTGGCAGTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004846
VALIDATED
EIF4E2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E family member 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-176s21c1
Sequence:CCGGCGGAACGAGACAAGAATCAGACTCGAGTCTGATTCTTGTCTCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-121s21c1
Sequence:CCGGGACCATGATCAGAATGAAGAACTCGAGTTCTTCATTCTGATCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004846.2-417s21c1
Sequence:CCGGCCATCTCTTCAAAGAAGGAATCTCGAGATTCCTTCTTTGAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-627s21c1
Sequence:CCGGGAATAAGACTGCCAGTGACCACTCGAGTGGTCACTGGCAGTCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004846.2-598s21c1
Sequence:CCGGCGCTTTCAGGAAGACATTATTCTCGAGAATAATGTCTTCCTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-117s1c1
Sequence:CCGGCGAGACAAGAATCAGAGCAGTCTCGAGACTGCTCTGATTCTTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-112s1c1
Sequence:CCGGCGGAACGAGACAAGAATCAGACTCGAGTCTGATTCTTGTCTCGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-57s1c1
Sequence:CCGGGACCATGATCAGAATGAAGAACTCGAGTTCTTCATTCTGATCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-238s1c1
Sequence:CCGGCACAGAGCTATGAACAGAATACTCGAGTATTCTGTTCATAGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004846.1-353s1c1
Sequence:CCGGCCATCTCTTCAAAGAAGGAATCTCGAGATTCCTTCTTTGAAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-534s1c1
Sequence:CCGGCGCTTTCAGGAAGACATTATTCTCGAGAATAATGTCTTCCTGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004846.1-179s1c1
Sequence:CCGGCCTGCAGTACAACTACACTTTCTCGAGAAAGTGTAGTTGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004846.1-83s1c1
Sequence:CCGGCACACAGAAAGATGGTGAGAACTCGAGTTCTCACCATCTTTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-563s1c1
Sequence:CCGGGAATAAGACTGCCAGTGACCACTCGAGTGGTCACTGGCAGTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004846
VALIDATED
EIF4E2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E family member 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-176s21c1
Sequence:CCGGCGGAACGAGACAAGAATCAGACTCGAGTCTGATTCTTGTCTCGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-121s21c1
Sequence:CCGGGACCATGATCAGAATGAAGAACTCGAGTTCTTCATTCTGATCATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004846.2-417s21c1
Sequence:CCGGCCATCTCTTCAAAGAAGGAATCTCGAGATTCCTTCTTTGAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004846.2-627s21c1
Sequence:CCGGGAATAAGACTGCCAGTGACCACTCGAGTGGTCACTGGCAGTCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004846.2-598s21c1
Sequence:CCGGCGCTTTCAGGAAGACATTATTCTCGAGAATAATGTCTTCCTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-117s1c1
Sequence:CCGGCGAGACAAGAATCAGAGCAGTCTCGAGACTGCTCTGATTCTTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-112s1c1
Sequence:CCGGCGGAACGAGACAAGAATCAGACTCGAGTCTGATTCTTGTCTCGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-57s1c1
Sequence:CCGGGACCATGATCAGAATGAAGAACTCGAGTTCTTCATTCTGATCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-238s1c1
Sequence:CCGGCACAGAGCTATGAACAGAATACTCGAGTATTCTGTTCATAGCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004846.1-353s1c1
Sequence:CCGGCCATCTCTTCAAAGAAGGAATCTCGAGATTCCTTCTTTGAAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004846.1-534s1c1
Sequence:CCGGCGCTTTCAGGAAGACATTATTCTCGAGAATAATGTCTTCCTGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004846.1-179s1c1
Sequence:CCGGCCTGCAGTACAACTACACTTTCTCGAGAAAGTGTAGTTGTACTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004846.1-83s1c1
Sequence:CCGGCACACAGAAAGATGGTGAGAACTCGAGTTCTCACCATCTTTCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004846.1-563s1c1
Sequence:CCGGGAATAAGACTGCCAGTGACCACTCGAGTGGTCACTGGCAGTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks