EMAIL THIS PAGE TO A FRIEND

EIF4E3

eukaryotic translation initiation factor 4E family member 3

165 Gene Product Result for
UniProtKB ID: Q8N5X7, B2R963, Q6NUT1
Gene ID:
Human(317649) Summary: EIF4E3 belongs to the EIF4E family of translational initiation factors that interact with the 5-prime cap structure of mRNA and recruit mRNA to the ribosome (Joshi et al., 2004 [PubMed 15153109]
Mouse(66892) eukaryotic translation initiation factor 4E member 3
Rat(297481) eukaryotic translation initiation factor 4E family member 3
Zebrafish(447850) eukaryotic translation initiation factor 4E family member 3
chicken(416093) eukaryotic translation initiation factor 4E family member 3
domestic cat(101092589) eukaryotic translation initiation factor 4E family member 3
cow(616906) eukaryotic translation initiation factor 4E family member 3
dog(484691) eukaryotic translation initiation factor 4E family member 3
Thale Cress(839836) translation initiation factor eIF-4E
sheep(101114394) eukaryotic translation initiation factor 4E family member 3
domestic guinea pig(100733615) eukaryotic translation initiation factor 4E family member 3
naked mole-rat(101721733) eukaryotic translation initiation factor 4E family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021311 MISSION® esiRNA esiRNA human EIF4E3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173359 Rosetta Predictions human pricing
NM_001106612 Rosetta Predictions rat pricing
NM_025829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034835 predicted 588
2 SASI_Hs01_00034837 predicted 637
3 SASI_Hs01_00034838 predicted 611
4 SASI_Hs01_00034840 predicted 1269
5 SASI_Hs01_00034836 predicted 493
6 SASI_Hs01_00034842 predicted 1262
7 SASI_Hs01_00034843 predicted 1178
8 SASI_Hs01_00034844 predicted 926
9 SASI_Hs02_00368190 predicted 1163
10 SASI_Hs02_00368191 predicted 1280
11 SASI_Hs01_00034839 predicted 481
12 SASI_Hs01_00034841 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220658 predicted 249
2 SASI_Rn02_00220659 predicted 262
3 SASI_Rn02_00220660 predicted 211
4 SASI_Rn02_00220661 predicted 260
5 SASI_Rn02_00220662 predicted 500
6 SASI_Rn02_00220663 predicted 417
7 SASI_Rn02_00220664 predicted 275
8 SASI_Rn02_00220665 predicted 324
9 SASI_Rn02_00220666 predicted 361
10 SASI_Rn02_00220667 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151029 predicted 472
2 SASI_Mm01_00151030 predicted 197
3 SASI_Mm01_00151031 predicted 266
4 SASI_Mm01_00151032 predicted 252
5 SASI_Mm01_00151034 predicted 208
6 SASI_Mm01_00151035 predicted 480
7 SASI_Mm01_00151036 predicted 415
8 SASI_Mm01_00151037 predicted 372
9 SASI_Mm01_00151038 predicted 298
10 SASI_Mm02_00329092 predicted 354
11 SASI_Mm01_00151033 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173359
EIF4E3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E family member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1146s1c1
Sequence:CCGGCCTTTCATTGAGGCACAAGAACTCGAGTTCTTGTGCCTCAATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173359.3-764s1c1
Sequence:CCGGCCATGAAGAGCATCATGCTTTCTCGAGAAAGCATGATGCTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173359.3-600s1c1
Sequence:CCGGGCAGCAGATGATGAAGTAATACTCGAGTATTACTTCATCATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173359.3-546s1c1
Sequence:CCGGGTTTGGAAAGAGTTGCTGTTACTCGAGTAACAGCAACTCTTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173359.3-665s1c1
Sequence:CCGGCTGGAATGTAAATGCCTCTTTCTCGAGAAAGAGGCATTTACATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1610s1c1
Sequence:CCGGCCAATAGGAAACCTGATGTTTCTCGAGAAACATCAGGTTTCCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1186s1c1
Sequence:CCGGGCTCTGCTGTACCTAGTTAATCTCGAGATTAACTAGGTACAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173359
EIF4E3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E family member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1146s1c1
Sequence:CCGGCCTTTCATTGAGGCACAAGAACTCGAGTTCTTGTGCCTCAATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173359.3-764s1c1
Sequence:CCGGCCATGAAGAGCATCATGCTTTCTCGAGAAAGCATGATGCTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173359.3-600s1c1
Sequence:CCGGGCAGCAGATGATGAAGTAATACTCGAGTATTACTTCATCATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173359.3-546s1c1
Sequence:CCGGGTTTGGAAAGAGTTGCTGTTACTCGAGTAACAGCAACTCTTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173359.3-665s1c1
Sequence:CCGGCTGGAATGTAAATGCCTCTTTCTCGAGAAAGAGGCATTTACATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1610s1c1
Sequence:CCGGCCAATAGGAAACCTGATGTTTCTCGAGAAACATCAGGTTTCCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1186s1c1
Sequence:CCGGGCTCTGCTGTACCTAGTTAATCTCGAGATTAACTAGGTACAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173359
EIF4E3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E family member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149967    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1146s1c1
Sequence:CCGGCCTTTCATTGAGGCACAAGAACTCGAGTTCTTGTGCCTCAATGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173359.3-764s1c1
Sequence:CCGGCCATGAAGAGCATCATGCTTTCTCGAGAAAGCATGATGCTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173359.3-600s1c1
Sequence:CCGGGCAGCAGATGATGAAGTAATACTCGAGTATTACTTCATCATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173359.3-546s1c1
Sequence:CCGGGTTTGGAAAGAGTTGCTGTTACTCGAGTAACAGCAACTCTTTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173359.3-665s1c1
Sequence:CCGGCTGGAATGTAAATGCCTCTTTCTCGAGAAAGAGGCATTTACATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146957    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1610s1c1
Sequence:CCGGCCAATAGGAAACCTGATGTTTCTCGAGAAACATCAGGTTTCCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173359.3-1186s1c1
Sequence:CCGGGCTCTGCTGTACCTAGTTAATCTCGAGATTAACTAGGTACAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025829
VALIDATED
EIF4E3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E family member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025829.2-2221s1c1
Sequence:CCGGCGTGCATTTCTCTGAACAGTTCTCGAGAACTGTTCAGAGAAATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-215s1c1
Sequence:CCGGGCAGATATTCTGGAGTGTATACTCGAGTATACACTCCAGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-390s1c1
Sequence:CCGGGAATTGTTGTTAGCGACCATTCTCGAGAATGGTCGCTAACAACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-202s1c1
Sequence:CCGGCGGTACAAACAGTGCAGATATCTCGAGATATCTGCACTGTTTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025829
VALIDATED
EIF4E3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E family member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025829.2-2221s1c1
Sequence:CCGGCGTGCATTTCTCTGAACAGTTCTCGAGAACTGTTCAGAGAAATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-215s1c1
Sequence:CCGGGCAGATATTCTGGAGTGTATACTCGAGTATACACTCCAGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-390s1c1
Sequence:CCGGGAATTGTTGTTAGCGACCATTCTCGAGAATGGTCGCTAACAACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-202s1c1
Sequence:CCGGCGGTACAAACAGTGCAGATATCTCGAGATATCTGCACTGTTTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025829
VALIDATED
EIF4E3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E family member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025829.2-2221s1c1
Sequence:CCGGCGTGCATTTCTCTGAACAGTTCTCGAGAACTGTTCAGAGAAATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-215s1c1
Sequence:CCGGGCAGATATTCTGGAGTGTATACTCGAGTATACACTCCAGAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-390s1c1
Sequence:CCGGGAATTGTTGTTAGCGACCATTCTCGAGAATGGTCGCTAACAACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025829.2-202s1c1
Sequence:CCGGCGGTACAAACAGTGCAGATATCTCGAGATATCTGCACTGTTTGTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks