EMAIL THIS PAGE TO A FRIEND

EIF4E

eukaryotic translation initiation factor 4E

125 Gene Product Result for
Synonyms: AUTS19 CBP EIF4E1 EIF4EL1 EIF4F
UniProtKB ID: P06730, B7Z6V1, D6RCQ6, Q96E95
Gene ID:
Human(1977) Summary: The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of cellular mRNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the mRNA. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(13684) eukaryotic translation initiation factor 4E
Rat(117045) eukaryotic translation initiation factor 4E
Thale Cress(827529) translation initiation factor eIF-4E
domestic cat(101080377) eukaryotic translation initiation factor 4E
cow(281751) eukaryotic translation initiation factor 4E
dog(487870) eukaryotic translation initiation factor 4E
chicken(422703) eukaryotic translation initiation factor 4E
sheep(101112730) eukaryotic translation initiation factor 4E
Domestic Rabbit(100009338) eukaryotic translation initiation factor 4E
domestic guinea pig(100718596) eukaryotic translation initiation factor 4E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300485 Anti-EIF4E (Ab-209) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1405749 Anti-EIF4E antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
E5906 Anti-eIF4E antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat (predicted), mouse
immunocytochemistry, immunoprecipitation, western blot pricing
SAB2100666 Anti-EIF4E antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, zebrafish, rat, bovine, human, guinea pig, rabbit
western blot pricing
SAB2107353 Anti-EIF4E antibody produced in rabbit affinity isolated antibody rat, horse, rabbit, human, guinea pig
ELISA, western blot pricing
HPA051311 Anti-EIF4E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4500735 Anti-EIF4E, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504389 Anti-phospho-eIF4E (pSer209) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300188 Anti-phospho-EIF4E (pSer209) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4100304 Monoclonal Anti-EIF4E antibody produced in mouse clone EIF4E-A258, culture supernatant human
western blot pricing
SAB4100305 Monoclonal Anti-EIF4E antibody produced in mouse clone EIF4E-B258, culture supernatant human
western blot pricing
SAB5300107 Monoclonal Anti-EIF4E antibody produced in mouse clone 5D11, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001968 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094691 MISSION® esiRNA esiRNA targeting mouse Eif4e (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001968 Rosetta Predictions human pricing
NM_053974 Rosetta Predictions rat pricing
NM_007917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216117 predicted 1027
2 SASI_Hs01_00216118 predicted 1221
3 SASI_Hs02_00332927 predicted 1144
4 SASI_Hs01_00216120 predicted 1342
5 SASI_Hs01_00216121 predicted 1256
6 SASI_Hs02_00332928 predicted 1408
7 SASI_Hs01_00216123 predicted 923
8 SASI_Hs01_00216124 predicted 974
9 SASI_Hs01_00216125 predicted 1394
10 SASI_Hs01_00216126 predicted 1043
11 SASI_Hs01_00216119 predicted 1072
12 SASI_Hs01_00216122 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052604 predicted 376
2 SASI_Rn01_00052605 predicted 877
3 SASI_Rn01_00052606 predicted 494
4 SASI_Rn01_00052607 predicted 768
5 SASI_Rn01_00052608 predicted 546
6 SASI_Rn01_00052609 predicted 225
7 SASI_Rn01_00052610 predicted 196
8 SASI_Rn01_00052612 predicted 538
9 SASI_Rn01_00052613 predicted 482
10 SASI_Rn02_00266960 predicted 341
11 SASI_Rn01_00052611 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070393 predicted 430
2 SASI_Mm01_00070394 predicted 829
3 SASI_Mm02_00312729 predicted 368
4 SASI_Mm01_00070395 predicted 674
5 SASI_Mm01_00070396 predicted 301
6 SASI_Mm01_00070397 predicted 310
7 SASI_Mm01_00070399 predicted 194
8 SASI_Mm01_00070400 predicted 421
9 SASI_Mm01_00070401 predicted 192
10 SASI_Mm01_00070402 predicted 664
11 SASI_Mm01_00070398 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007917
VALIDATED
EIF4E MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007917.2-2283s1c1
Sequence:CCGGGCTCTTTAAGTGGTGGTTGTTCTCGAGAACAACCACCACTTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-585s1c1
Sequence:CCGGCCGAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-191s1c1
Sequence:CCGGCCTTCGATTGATCTCTAAGTTCTCGAGAACTTAGAGATCAATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-182s1c1
Sequence:CCGGGCAAGCAAACCTTCGATTGATCTCGAGATCAATCGAAGGTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-195s1c1
Sequence:CCGGCGATTGATCTCTAAGTTTGATCTCGAGATCAAACTTAGAGATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007917
VALIDATED
EIF4E MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007917.2-2283s1c1
Sequence:CCGGGCTCTTTAAGTGGTGGTTGTTCTCGAGAACAACCACCACTTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-585s1c1
Sequence:CCGGCCGAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-191s1c1
Sequence:CCGGCCTTCGATTGATCTCTAAGTTCTCGAGAACTTAGAGATCAATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-182s1c1
Sequence:CCGGGCAAGCAAACCTTCGATTGATCTCGAGATCAATCGAAGGTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-195s1c1
Sequence:CCGGCGATTGATCTCTAAGTTTGATCTCGAGATCAAACTTAGAGATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007917
VALIDATED
EIF4E MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007917.2-2283s1c1
Sequence:CCGGGCTCTTTAAGTGGTGGTTGTTCTCGAGAACAACCACCACTTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-585s1c1
Sequence:CCGGCCGAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-191s1c1
Sequence:CCGGCCTTCGATTGATCTCTAAGTTCTCGAGAACTTAGAGATCAATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-182s1c1
Sequence:CCGGGCAAGCAAACCTTCGATTGATCTCGAGATCAATCGAAGGTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007917.2-195s1c1
Sequence:CCGGCGATTGATCTCTAAGTTTGATCTCGAGATCAAACTTAGAGATCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001968
VALIDATED
EIF4E MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1774s1c1
Sequence:CCGGCCACTCTGTAATAGTTCAGTACTCGAGTACTGAACTATTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-898s1c1
Sequence:CCGGCCGACTACAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1426s1c1
Sequence:CCGGCCAAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001968.2-1310s1c1
Sequence:CCGGCTGTTGTTAATGTTAGAGCTACTCGAGTAGCTCTAACATTAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1036s1c1
Sequence:CCGGCGGCTGATCTCCAAGTTTGATCTCGAGATCAAACTTGGAGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-1704s21c1
Sequence:CCGGCGGCTGATCTCCAAGTTTGATCTCGAGATCAAACTTGGAGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-1566s21c1
Sequence:CCGGCCGACTACAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-2094s21c1
Sequence:CCGGCCAAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001968.3-2442s21c1
Sequence:CCGGCCACTCTGTAATAGTTCAGTACTCGAGTACTGAACTATTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001968
VALIDATED
EIF4E MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1774s1c1
Sequence:CCGGCCACTCTGTAATAGTTCAGTACTCGAGTACTGAACTATTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-898s1c1
Sequence:CCGGCCGACTACAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1426s1c1
Sequence:CCGGCCAAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001968.2-1310s1c1
Sequence:CCGGCTGTTGTTAATGTTAGAGCTACTCGAGTAGCTCTAACATTAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1036s1c1
Sequence:CCGGCGGCTGATCTCCAAGTTTGATCTCGAGATCAAACTTGGAGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-1704s21c1
Sequence:CCGGCGGCTGATCTCCAAGTTTGATCTCGAGATCAAACTTGGAGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-1566s21c1
Sequence:CCGGCCGACTACAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-2094s21c1
Sequence:CCGGCCAAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001968.3-2442s21c1
Sequence:CCGGCCACTCTGTAATAGTTCAGTACTCGAGTACTGAACTATTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001968
VALIDATED
EIF4E MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1774s1c1
Sequence:CCGGCCACTCTGTAATAGTTCAGTACTCGAGTACTGAACTATTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-898s1c1
Sequence:CCGGCCGACTACAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1426s1c1
Sequence:CCGGCCAAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001968.2-1310s1c1
Sequence:CCGGCTGTTGTTAATGTTAGAGCTACTCGAGTAGCTCTAACATTAACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001968.2-1036s1c1
Sequence:CCGGCGGCTGATCTCCAAGTTTGATCTCGAGATCAAACTTGGAGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-1704s21c1
Sequence:CCGGCGGCTGATCTCCAAGTTTGATCTCGAGATCAAACTTGGAGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-1566s21c1
Sequence:CCGGCCGACTACAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001968.3-2094s21c1
Sequence:CCGGCCAAAGATAGTGATTGGTTATCTCGAGATAACCAATCACTATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001968.3-2442s21c1
Sequence:CCGGCCACTCTGTAATAGTTCAGTACTCGAGTACTGAACTATTACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks