EMAIL THIS PAGE TO A FRIEND

EIF4EBP1

eukaryotic translation initiation factor 4E binding protein 1

Synonyms: 4E-BP1 4EBP1 BP-1 PHAS-I
UniProtKB ID: Q13541, B2R502, D3DSW8, Q6IBN3
Gene ID:
Human(1978) Summary: This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation. [provided by RefSeq, Jul 2008]
Mouse(13685) eukaryotic translation initiation factor 4E binding protein 1
Rat(116636) eukaryotic translation initiation factor 4E binding protein 1
Zebrafish(799566) eukaryotic translation initiation factor 4E binding protein 1
dog(475590) eukaryotic translation initiation factor 4E binding protein 1
cow(509613) eukaryotic translation initiation factor 4E binding protein 1
domestic cat(101088571) eukaryotic translation initiation factor 4E binding protein 1
chicken(426773) eukaryotic translation initiation factor 4E binding protein 1
naked mole-rat(101710614) eukaryotic translation initiation factor 4E binding protein 1
domestic guinea pig(100733182) eukaryotic translation initiation factor 4E binding protein 1
Goat(100861097) eukaryotic translation initiation factor 4E binding protein 1
sheep(101111426) eukaryotic translation initiation factor 4E binding protein 1
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500210 Anti-4E-BP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB4500736 Anti-4E-BP1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4500737 Anti-4E-BP1 antibody produced in rabbit affinity isolated antibody rat, mouse
immunohistochemistry, western blot pricing
SAB4500738 Anti-4E-BP1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
SAB4500739 Anti-4E-BP1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4500740 Anti-4E-BP1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300474 Anti-EIF4EBP1 (Ab-36) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4300475 Anti-EIF4EBP1 (Ab-45) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA023501 Anti-EIF4EBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2106955 Anti-EIF4EBP1 antibody produced in rabbit affinity isolated antibody mouse, human, guinea pig, rabbit, horse
ELISA, western blot pricing
SAB4503847 Anti-phospho-4E-BP1 (pSer64) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504328 Anti-phospho-4E-BP1 (pThr36) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504329 Anti-phospho-4E-BP1 (pThr45) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503848 Anti-phospho-4E-BP1 (pThr69) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504686 Anti-phospho-4E-BP1 (pThr70) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4301339 Anti-phospho-4E-BP1 (pThr70) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4300179 Anti-phospho-EIF4EBP1 (pThr45) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
WH0001978M1 Monoclonal Anti-EIF4EBP1 antibody produced in mouse clone 4F3-H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403761 Monoclonal Anti-EIF4EBP1 antibody produced in mouse clone 1F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300484 Monoclonal Anti-EIF4EBP1 antibody produced in mouse clone 9E12D9, ascites fluid human
ELISA, western blot pricing
SAB5300486 Monoclonal Anti-EIF4EBP1 antibody produced in mouse clone 11G12C11, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004095 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004095 Rosetta Predictions human pricing
NM_053857 Rosetta Predictions rat pricing
NM_007918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336903 predicted 362
2 SASI_Hs01_00077267 predicted 612
3 SASI_Hs02_00336904 predicted 364
4 SASI_Hs02_00336905 predicted 435
5 SASI_Hs02_00336906 predicted 431
6 SASI_Hs01_00077258 predicted 397
7 SASI_Hs01_00077259 predicted 241
8 SASI_Hs01_00077260 predicted 387
9 SASI_Hs02_00336907 predicted 553
10 SASI_Hs01_00077261 predicted 607
11 SASI_Hs01_00077262 predicted 612
12 SASI_Hs01_00077263 predicted 255
13 SASI_Hs01_00077264 predicted 254
14 SASI_Hs01_00077265 predicted 387
15 SASI_Hs01_00077266 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110492 predicted 571
2 SASI_Rn02_00266721 predicted 374
3 SASI_Rn02_00266722 predicted 571
4 SASI_Rn01_00110493 predicted 604
5 SASI_Rn01_00110495 predicted 303
6 SASI_Rn01_00110496 predicted 386
7 SASI_Rn01_00110497 predicted 198
8 SASI_Rn01_00110498 predicted 514
9 SASI_Rn01_00110499 predicted 191
10 SASI_Rn01_00110500 predicted 210
11 SASI_Rn01_00110494 predicted 603
12 SASI_Rn01_00110501 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312730 predicted 225
2 SASI_Mm01_00057814 predicted 396
3 SASI_Mm01_00057815 predicted 448
4 SASI_Mm01_00057816 predicted 410
5 SASI_Mm01_00057817 predicted 549
6 SASI_Mm02_00312731 predicted 698
7 SASI_Mm02_00312732 predicted 251
8 SASI_Mm02_00312733 predicted 707
9 SASI_Mm01_00057821 predicted 327
10 SASI_Mm02_00312734 predicted 215
11 SASI_Mm01_00057818 predicted 623
12 SASI_Mm01_00057819 predicted 224
13 SASI_Mm01_00057820 predicted 623
14 SASI_Mm01_00057822 predicted 345
15 SASI_Mm01_00057823 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007918
VALIDATED
EIF4EBP1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007918.2-838s1c1
Sequence:CCGGCCAGTGTTTATGGTGTGATTTCTCGAGAAATCACACCATAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-326s1c1
Sequence:CCGGAGGCGGTGAAGAGTCACAATTCTCGAGAATTGTGACTCTTCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-219s1c1
Sequence:CCGGCCAAAGGACCTGCCAGCCATTCTCGAGAATGGCTGGCAGGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007918.2-155s1c1
Sequence:CCGGCAGGATTATCTATGACCGGAACTCGAGTTCCGGTCATAGATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-338s1c1
Sequence:CCGGGTCACAATTTGAGATGGACATCTCGAGATGTCCATCTCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-233s21c1
Sequence:CCGGATTATCTATGACCGGAAATTTCTCGAGAAATTTCCGGTCATAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-400s21c1
Sequence:CCGGAGGCGGTGAAGAGTCACAATTCTCGAGAATTGTGACTCTTCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-293s21c1
Sequence:CCGGCCAAAGGACCTGCCAGCCATTCTCGAGAATGGCTGGCAGGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-412s21c1
Sequence:CCGGGTCACAATTTGAGATGGACATCTCGAGATGTCCATCTCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007918
VALIDATED
EIF4EBP1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007918.2-838s1c1
Sequence:CCGGCCAGTGTTTATGGTGTGATTTCTCGAGAAATCACACCATAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-326s1c1
Sequence:CCGGAGGCGGTGAAGAGTCACAATTCTCGAGAATTGTGACTCTTCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-219s1c1
Sequence:CCGGCCAAAGGACCTGCCAGCCATTCTCGAGAATGGCTGGCAGGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007918.2-155s1c1
Sequence:CCGGCAGGATTATCTATGACCGGAACTCGAGTTCCGGTCATAGATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-338s1c1
Sequence:CCGGGTCACAATTTGAGATGGACATCTCGAGATGTCCATCTCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-233s21c1
Sequence:CCGGATTATCTATGACCGGAAATTTCTCGAGAAATTTCCGGTCATAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-400s21c1
Sequence:CCGGAGGCGGTGAAGAGTCACAATTCTCGAGAATTGTGACTCTTCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-293s21c1
Sequence:CCGGCCAAAGGACCTGCCAGCCATTCTCGAGAATGGCTGGCAGGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-412s21c1
Sequence:CCGGGTCACAATTTGAGATGGACATCTCGAGATGTCCATCTCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007918
VALIDATED
EIF4EBP1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007918.2-838s1c1
Sequence:CCGGCCAGTGTTTATGGTGTGATTTCTCGAGAAATCACACCATAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-326s1c1
Sequence:CCGGAGGCGGTGAAGAGTCACAATTCTCGAGAATTGTGACTCTTCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-219s1c1
Sequence:CCGGCCAAAGGACCTGCCAGCCATTCTCGAGAATGGCTGGCAGGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007918.2-155s1c1
Sequence:CCGGCAGGATTATCTATGACCGGAACTCGAGTTCCGGTCATAGATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007918.2-338s1c1
Sequence:CCGGGTCACAATTTGAGATGGACATCTCGAGATGTCCATCTCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-233s21c1
Sequence:CCGGATTATCTATGACCGGAAATTTCTCGAGAAATTTCCGGTCATAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-400s21c1
Sequence:CCGGAGGCGGTGAAGAGTCACAATTCTCGAGAATTGTGACTCTTCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-293s21c1
Sequence:CCGGCCAAAGGACCTGCCAGCCATTCTCGAGAATGGCTGGCAGGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007918.3-412s21c1
Sequence:CCGGGTCACAATTTGAGATGGACATCTCGAGATGTCCATCTCAAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004095
VALIDATED
EIF4EBP1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-358s1c1
Sequence:CCGGGCGCAATAGCCCAGAAGATAACTCGAGTTATCTTCTGGGCTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004095.2-215s1c1
Sequence:CCGGAGGATCATCTATGACCGGAAACTCGAGTTTCCGGTCATAGATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-400s1c1
Sequence:CCGGACAGTTTGAGATGGACATTTACTCGAGTAAATGTCCATCTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-388s1c1
Sequence:CCGGCGGTGAAGAGTCACAGTTTGACTCGAGTCAAACTGTGACTCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-489s1c1
Sequence:CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCATAAGGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-497s21c1
Sequence:CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCATAAGGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-396s21c1
Sequence:CCGGCGGTGAAGAGTCACAGTTTGACTCGAGTCAAACTGTGACTCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-366s21c1
Sequence:CCGGGCGCAATAGCCCAGAAGATAACTCGAGTTATCTTCTGGGCTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-408s21c1
Sequence:CCGGACAGTTTGAGATGGACATTTACTCGAGTAAATGTCCATCTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004095
VALIDATED
EIF4EBP1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-358s1c1
Sequence:CCGGGCGCAATAGCCCAGAAGATAACTCGAGTTATCTTCTGGGCTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004095.2-215s1c1
Sequence:CCGGAGGATCATCTATGACCGGAAACTCGAGTTTCCGGTCATAGATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-400s1c1
Sequence:CCGGACAGTTTGAGATGGACATTTACTCGAGTAAATGTCCATCTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-388s1c1
Sequence:CCGGCGGTGAAGAGTCACAGTTTGACTCGAGTCAAACTGTGACTCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-489s1c1
Sequence:CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCATAAGGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-497s21c1
Sequence:CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCATAAGGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-396s21c1
Sequence:CCGGCGGTGAAGAGTCACAGTTTGACTCGAGTCAAACTGTGACTCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-366s21c1
Sequence:CCGGGCGCAATAGCCCAGAAGATAACTCGAGTTATCTTCTGGGCTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-408s21c1
Sequence:CCGGACAGTTTGAGATGGACATTTACTCGAGTAAATGTCCATCTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004095
VALIDATED
EIF4EBP1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-358s1c1
Sequence:CCGGGCGCAATAGCCCAGAAGATAACTCGAGTTATCTTCTGGGCTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004095.2-215s1c1
Sequence:CCGGAGGATCATCTATGACCGGAAACTCGAGTTTCCGGTCATAGATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-400s1c1
Sequence:CCGGACAGTTTGAGATGGACATTTACTCGAGTAAATGTCCATCTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-388s1c1
Sequence:CCGGCGGTGAAGAGTCACAGTTTGACTCGAGTCAAACTGTGACTCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004095.2-489s1c1
Sequence:CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCATAAGGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-497s21c1
Sequence:CCGGGCCAGGCCTTATGAAAGTGATCTCGAGATCACTTTCATAAGGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-396s21c1
Sequence:CCGGCGGTGAAGAGTCACAGTTTGACTCGAGTCAAACTGTGACTCTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-366s21c1
Sequence:CCGGGCGCAATAGCCCAGAAGATAACTCGAGTTATCTTCTGGGCTATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004095.3-408s21c1
Sequence:CCGGACAGTTTGAGATGGACATTTACTCGAGTAAATGTCCATCTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks