EMAIL THIS PAGE TO A FRIEND

EIF4EBP2

eukaryotic translation initiation factor 4E binding protein 2

145 Gene Product Result for
Synonyms: 4EBP2 PHASII
UniProtKB ID: Q13542
Gene ID:
Human(1979) Summary: This gene encodes a member of the eukaryotic translation initiation factor 4E binding protein family. The gene products of this family bind eIF4E and inhibit translation initiation. However, insulin and other growth factors can release this inhibition via a phosphorylation-dependent disruption of their binding to eIF4E. Regulation of protein production through these gene products have been implicated in cell proliferation, cell differentiation and viral infection. [provided by RefSeq, Oct 2008]
Mouse(13688) eukaryotic translation initiation factor 4E binding protein 2
Rat(361845) eukaryotic translation initiation factor 4E binding protein 2
Zebrafish(386945) eukaryotic translation initiation factor 4E binding protein 2
cow(782397) eukaryotic translation initiation factor 4E binding protein 2
domestic cat(101099906) eukaryotic translation initiation factor 4E binding protein 2
chicken(769479) eukaryotic translation initiation factor 4E binding protein 2
dog(489027) eukaryotic translation initiation factor 4E binding protein 2
Goat(100861353) eukaryotic translation initiation factor 4E binding protein 2
sheep(101110115) eukaryotic translation initiation factor 4E binding protein 2
naked mole-rat(101715691) eukaryotic translation initiation factor 4E binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004096 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004096 Rosetta Predictions human pricing
NM_001033069 Rosetta Predictions rat pricing
NM_010124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213939 predicted 818
2 SASI_Hs01_00213940 predicted 645
3 SASI_Hs01_00213941 predicted 420
4 SASI_Hs01_00213942 predicted 650
5 SASI_Hs01_00213943 predicted 849
6 SASI_Hs02_00336908 predicted 1015
7 SASI_Hs01_00213944 predicted 572
8 SASI_Hs01_00213945 predicted 678
9 SASI_Hs01_00213946 predicted 629
10 SASI_Hs01_00213947 predicted 1051
11 SASI_Hs01_00213938 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076973 predicted 301
2 SASI_Rn01_00076974 predicted 526
3 SASI_Rn01_00076975 predicted 645
4 SASI_Rn01_00076976 predicted 542
5 SASI_Rn01_00076977 predicted 639
6 SASI_Rn02_00203632 predicted 319
7 SASI_Rn01_00076978 predicted 329
8 SASI_Rn02_00203633 predicted 533
9 SASI_Rn01_00076980 predicted 516
10 SASI_Rn01_00076981 predicted 287
11 SASI_Rn01_00076979 predicted 345
12 SASI_Rn01_00076982 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317845 predicted 691
2 SASI_Mm01_00068654 predicted 366
3 SASI_Mm02_00317846 predicted 719
4 SASI_Mm01_00068655 predicted 647
5 SASI_Mm01_00068657 predicted 600
6 SASI_Mm01_00068659 predicted 325
7 SASI_Mm01_00068660 predicted 524
8 SASI_Mm01_00068661 predicted 334
9 SASI_Mm01_00068662 predicted 294
10 SASI_Mm01_00068663 predicted 603
11 SASI_Mm01_00068656 predicted 699
12 SASI_Mm01_00068658 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004096
VALIDATED
EIF4EBP2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-380s21c1
Sequence:CCGGCGCAGCTACCTCATGACTATTCTCGAGAATAGTCATGAGGTAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-437s21c1
Sequence:CCGGCGGGAGGAACTCGAATCATTTCTCGAGAAATGATTCGAGTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004096.4-898s21c1
Sequence:CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-551s21c1
Sequence:CCGGGCACCTTAATTGAAGACTCCACTCGAGTGGAGTCTTCAATTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004096.3-837s1c1
Sequence:CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-490s1c1
Sequence:CCGGGCACCTTAATTGAAGACTCCACTCGAGTGGAGTCTTCAATTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-385s1c1
Sequence:CCGGCTCGAATCATTTATGACAGAACTCGAGTTCTGTCATAAATGATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-319s1c1
Sequence:CCGGCGCAGCTACCTCATGACTATTCTCGAGAATAGTCATGAGGTAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-376s1c1
Sequence:CCGGCGGGAGGAACTCGAATCATTTCTCGAGAAATGATTCGAGTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004096
VALIDATED
EIF4EBP2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-380s21c1
Sequence:CCGGCGCAGCTACCTCATGACTATTCTCGAGAATAGTCATGAGGTAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-437s21c1
Sequence:CCGGCGGGAGGAACTCGAATCATTTCTCGAGAAATGATTCGAGTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004096.4-898s21c1
Sequence:CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-551s21c1
Sequence:CCGGGCACCTTAATTGAAGACTCCACTCGAGTGGAGTCTTCAATTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004096.3-837s1c1
Sequence:CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-490s1c1
Sequence:CCGGGCACCTTAATTGAAGACTCCACTCGAGTGGAGTCTTCAATTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-385s1c1
Sequence:CCGGCTCGAATCATTTATGACAGAACTCGAGTTCTGTCATAAATGATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-319s1c1
Sequence:CCGGCGCAGCTACCTCATGACTATTCTCGAGAATAGTCATGAGGTAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-376s1c1
Sequence:CCGGCGGGAGGAACTCGAATCATTTCTCGAGAAATGATTCGAGTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004096
VALIDATED
EIF4EBP2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-380s21c1
Sequence:CCGGCGCAGCTACCTCATGACTATTCTCGAGAATAGTCATGAGGTAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-437s21c1
Sequence:CCGGCGGGAGGAACTCGAATCATTTCTCGAGAAATGATTCGAGTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004096.4-898s21c1
Sequence:CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004096.4-551s21c1
Sequence:CCGGGCACCTTAATTGAAGACTCCACTCGAGTGGAGTCTTCAATTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004096.3-837s1c1
Sequence:CCGGGCTGTATTTCTGTAGAGCTAACTCGAGTTAGCTCTACAGAAATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-490s1c1
Sequence:CCGGGCACCTTAATTGAAGACTCCACTCGAGTGGAGTCTTCAATTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-385s1c1
Sequence:CCGGCTCGAATCATTTATGACAGAACTCGAGTTCTGTCATAAATGATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-319s1c1
Sequence:CCGGCGCAGCTACCTCATGACTATTCTCGAGAATAGTCATGAGGTAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004096.3-376s1c1
Sequence:CCGGCGGGAGGAACTCGAATCATTTCTCGAGAAATGATTCGAGTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010124
VALIDATED
EIF4EBP2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010124.1-733s1c1
Sequence:CCGGCCCTGGTCATTTCCCAAGAATCTCGAGATTCTTGGGAAATGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010124.1-375s1c1
Sequence:CCGGCGCCTTAATTGAAGACTCCAACTCGAGTTGGAGTCTTCAATTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010124.1-408s1c1
Sequence:CCGGCAACTTAAACAACCTGAACAACTCGAGTTGTTCAGGTTGTTTAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010124.1-393s1c1
Sequence:CCGGCAAAGTAGAAGTGAACAACTTCTCGAGAAGTTGTTCACTTCTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010124.1-269s1c1
Sequence:CCGGCACGAATCATTTATGACCGAACTCGAGTTCGGTCATAAATGATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010124
VALIDATED
EIF4EBP2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010124.1-733s1c1
Sequence:CCGGCCCTGGTCATTTCCCAAGAATCTCGAGATTCTTGGGAAATGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010124.1-375s1c1
Sequence:CCGGCGCCTTAATTGAAGACTCCAACTCGAGTTGGAGTCTTCAATTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010124.1-408s1c1
Sequence:CCGGCAACTTAAACAACCTGAACAACTCGAGTTGTTCAGGTTGTTTAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010124.1-393s1c1
Sequence:CCGGCAAAGTAGAAGTGAACAACTTCTCGAGAAGTTGTTCACTTCTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010124.1-269s1c1
Sequence:CCGGCACGAATCATTTATGACCGAACTCGAGTTCGGTCATAAATGATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010124
VALIDATED
EIF4EBP2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010124.1-733s1c1
Sequence:CCGGCCCTGGTCATTTCCCAAGAATCTCGAGATTCTTGGGAAATGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010124.1-375s1c1
Sequence:CCGGCGCCTTAATTGAAGACTCCAACTCGAGTTGGAGTCTTCAATTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010124.1-408s1c1
Sequence:CCGGCAACTTAAACAACCTGAACAACTCGAGTTGTTCAGGTTGTTTAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010124.1-393s1c1
Sequence:CCGGCAAAGTAGAAGTGAACAACTTCTCGAGAAGTTGTTCACTTCTACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010124.1-269s1c1
Sequence:CCGGCACGAATCATTTATGACCGAACTCGAGTTCGGTCATAAATGATTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks