EMAIL THIS PAGE TO A FRIEND

EIF4EBP3

eukaryotic translation initiation factor 4E binding protein 3

62 Gene Product Result for
Synonyms: 4E-BP3 4EBP3
UniProtKB ID: O60516
Gene ID:
Human(8637) Summary: This gene encodes a member of the EIF4EBP family, which consists of proteins that bind to eukaryotic translation initiation factor 4E and regulate its assembly into EIF4F, the multi-subunit translation initiation factor that recognizes the mRNA cap structure. Read-through transcription from the neighboring upstream gene (MASK or ANKHD1) generates a transcript (MASK-BP3) that encodes a protein comprised of the MASK protein sequence for the majority of the protein and a different C-terminus due to an alternate reading frame for the EIF4EBP3 segments. [provided by RefSeq, Oct 2010]
Mouse(108112) eukaryotic translation initiation factor 4E binding protein 3
Rat(100365872) eukaryotic translation initiation factor 4E binding protein 3
Zebrafish(492482) eukaryotic translation initiation factor 4E binding protein 3
dog(100529255) eukaryotic translation initiation factor 4E binding protein 3
Horse(100532744) eukaryotic translation initiation factor 4E binding protein 3
cow(100533104) eukaryotic translation initiation factor 4E binding protein 3
domestic cat(101094646) eukaryotic translation initiation factor 4E binding protein 3
naked mole-rat(101703204) eukaryotic translation initiation factor 4E binding protein 3
domestic guinea pig(100733914) eukaryotic translation initiation factor 4E binding protein 3
Domestic Rabbit(100532745) eukaryotic translation initiation factor 4E binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003732 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218031 MISSION® esiRNA esiRNA targeting human EIF4EBP3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003732 Rosetta Predictions human pricing
NM_201256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150995 predicted 383
2 SASI_Hs01_00150996 predicted 467
3 SASI_Hs01_00150997 predicted 453
4 SASI_Hs01_00150998 predicted 397
5 SASI_Hs01_00150999 predicted 459
6 SASI_Hs01_00151000 predicted 384
7 SASI_Hs01_00151001 predicted 455
8 SASI_Hs01_00151002 predicted 404
9 SASI_Hs01_00151003 predicted 388
10 SASI_Hs02_00336182 predicted 338
11 SASI_Hs01_00151004 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351502 predicted 413
2 SASI_Mm01_00165884 predicted 428
3 SASI_Mm01_00165885 predicted 418
4 SASI_Mm01_00165886 predicted 422
5 SASI_Mm01_00165887 predicted 290
6 SASI_Mm01_00165889 predicted 482
7 SASI_Mm02_00351503 predicted 406
8 SASI_Mm01_00165890 predicted 468
9 SASI_Mm01_00165891 predicted 400
10 SASI_Mm01_00165892 predicted 426
11 SASI_Mm01_00165888 predicted 425
12 SASI_Mm01_00165893 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201256
EIF4EBP3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201256.2-535s1c1
Sequence:CCGGTGGCCTCATCTAATCCAGAAACTCGAGTTTCTGGATTAGATGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-405s1c1
Sequence:CCGGGTAGAAATAACCGATGACGAACTCGAGTTCGTCATCGGTTATTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-425s1c1
Sequence:CCGGACAGTTTGAAATGGACATGTACTCGAGTACATGTCCATTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-248s1c1
Sequence:CCGGCAGGATCATCTACGACAGAAACTCGAGTTTCTGTCGTAGATGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-214s1c1
Sequence:CCGGGCGGCACACTATACGCCACTACTCGAGTAGTGGCGTATAGTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201256
EIF4EBP3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201256.2-535s1c1
Sequence:CCGGTGGCCTCATCTAATCCAGAAACTCGAGTTTCTGGATTAGATGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-405s1c1
Sequence:CCGGGTAGAAATAACCGATGACGAACTCGAGTTCGTCATCGGTTATTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-425s1c1
Sequence:CCGGACAGTTTGAAATGGACATGTACTCGAGTACATGTCCATTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-248s1c1
Sequence:CCGGCAGGATCATCTACGACAGAAACTCGAGTTTCTGTCGTAGATGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-214s1c1
Sequence:CCGGGCGGCACACTATACGCCACTACTCGAGTAGTGGCGTATAGTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201256
EIF4EBP3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201256.2-535s1c1
Sequence:CCGGTGGCCTCATCTAATCCAGAAACTCGAGTTTCTGGATTAGATGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-405s1c1
Sequence:CCGGGTAGAAATAACCGATGACGAACTCGAGTTCGTCATCGGTTATTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-425s1c1
Sequence:CCGGACAGTTTGAAATGGACATGTACTCGAGTACATGTCCATTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-248s1c1
Sequence:CCGGCAGGATCATCTACGACAGAAACTCGAGTTTCTGTCGTAGATGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201256.2-214s1c1
Sequence:CCGGGCGGCACACTATACGCCACTACTCGAGTAGTGGCGTATAGTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003732
EIF4EBP3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E binding protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-344s1c1
Sequence:CCGGCCGATGACGCACAATTTGAAACTCGAGTTTCAAATTGTGCGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-180s1c1
Sequence:CCGGCAGGATCATCTACGACCGAAACTCGAGTTTCGGTCGTAGATGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-322s1c1
Sequence:CCGGCAGGAGACAGAGGAAGAGATACTCGAGTATCTCTTCCTCTGTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-211s1c1
Sequence:CCGGGAGTGCAAGAACTCACCCATTCTCGAGAATGGGTGAGTTCTTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-351s1c1
Sequence:CCGGCGCACAATTTGAAATGGACATCTCGAGATGTCCATTTCAAATTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-387s21c1
Sequence:CCGGTGACCTGGCATGTGGAGTTACCTCGAGGTAACTCCACATGCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-551s21c1
Sequence:CCGGGGCAACTTGCCAAGCCCTTAACTCGAGTTAAGGGCTTGGCAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-482s21c1
Sequence:CCGGTGGAAGGGAGTGACTTGTTAGCTCGAGCTAACAAGTCACTCCCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003732
EIF4EBP3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E binding protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-344s1c1
Sequence:CCGGCCGATGACGCACAATTTGAAACTCGAGTTTCAAATTGTGCGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-180s1c1
Sequence:CCGGCAGGATCATCTACGACCGAAACTCGAGTTTCGGTCGTAGATGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-322s1c1
Sequence:CCGGCAGGAGACAGAGGAAGAGATACTCGAGTATCTCTTCCTCTGTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-211s1c1
Sequence:CCGGGAGTGCAAGAACTCACCCATTCTCGAGAATGGGTGAGTTCTTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-351s1c1
Sequence:CCGGCGCACAATTTGAAATGGACATCTCGAGATGTCCATTTCAAATTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-387s21c1
Sequence:CCGGTGACCTGGCATGTGGAGTTACCTCGAGGTAACTCCACATGCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-551s21c1
Sequence:CCGGGGCAACTTGCCAAGCCCTTAACTCGAGTTAAGGGCTTGGCAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-482s21c1
Sequence:CCGGTGGAAGGGAGTGACTTGTTAGCTCGAGCTAACAAGTCACTCCCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003732
EIF4EBP3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E binding protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-344s1c1
Sequence:CCGGCCGATGACGCACAATTTGAAACTCGAGTTTCAAATTGTGCGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-180s1c1
Sequence:CCGGCAGGATCATCTACGACCGAAACTCGAGTTTCGGTCGTAGATGATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-322s1c1
Sequence:CCGGCAGGAGACAGAGGAAGAGATACTCGAGTATCTCTTCCTCTGTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-211s1c1
Sequence:CCGGGAGTGCAAGAACTCACCCATTCTCGAGAATGGGTGAGTTCTTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003732.2-351s1c1
Sequence:CCGGCGCACAATTTGAAATGGACATCTCGAGATGTCCATTTCAAATTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-387s21c1
Sequence:CCGGTGACCTGGCATGTGGAGTTACCTCGAGGTAACTCCACATGCCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-551s21c1
Sequence:CCGGGGCAACTTGCCAAGCCCTTAACTCGAGTTAAGGGCTTGGCAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003732.2-482s21c1
Sequence:CCGGTGGAAGGGAGTGACTTGTTAGCTCGAGCTAACAAGTCACTCCCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks