EMAIL THIS PAGE TO A FRIEND

EIF4ENIF1

eukaryotic translation initiation factor 4E nuclear import factor 1

91 Gene Product Result for
Synonyms: 4E-T Clast4
UniProtKB ID: Q9NRA8, B1AKL2, B1AKL3, B2RBF1, Q8NCF2, Q9H708
Gene ID:
Human(56478) Summary: The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(74203) eukaryotic translation initiation factor 4E nuclear import factor 1
Rat(305468) eukaryotic translation initiation factor 4E nuclear import factor 1
Zebrafish(541411) eukaryotic translation initiation factor 4E nuclear import factor 1
cow(514108) eukaryotic translation initiation factor 4E nuclear import factor 1
Horse(100058294) eukaryotic translation initiation factor 4E nuclear import factor 1
domestic cat(101098583) eukaryotic translation initiation factor 4E nuclear import factor 1
dog(486366) eukaryotic translation initiation factor 4E nuclear import factor 1
chicken(416961) eukaryotic translation initiation factor 4E nuclear import factor 1
sheep(101116175) eukaryotic translation initiation factor 4E nuclear import factor 1
Domestic Rabbit(100328731) eukaryotic translation initiation factor 4E nuclear import factor 1
domestic guinea pig(100729498) eukaryotic translation initiation factor 4E nuclear import factor 1
naked mole-rat(101701223) eukaryotic translation initiation factor 4E nuclear import factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019843 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019843 Rosetta Predictions human pricing
NM_001107230 Rosetta Predictions rat pricing
NM_023743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053428 predicted 1913
2 SASI_Hs01_00053429 predicted 2685
3 SASI_Hs01_00053430 predicted 830
4 SASI_Hs02_00352852 predicted 1853
5 SASI_Hs01_00053431 predicted 2329
6 SASI_Hs01_00053433 predicted 1487
7 SASI_Hs01_00053434 predicted 564
8 SASI_Hs01_00053435 predicted 1945
9 SASI_Hs01_00053436 predicted 473
10 SASI_Hs02_00352853 predicted 2389
11 SASI_Hs01_00053432 predicted 647
12 SASI_Hs01_00053437 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226795 predicted 1948
2 SASI_Rn02_00226796 predicted 750
3 SASI_Rn02_00226797 predicted 1600
4 SASI_Rn02_00226798 predicted 1435
5 SASI_Rn02_00226799 predicted 2387
6 SASI_Rn02_00226800 predicted 812
7 SASI_Rn02_00226801 predicted 2734
8 SASI_Rn02_00226802 predicted 2439
9 SASI_Rn02_00226803 predicted 1133
10 SASI_Rn02_00226804 predicted 1971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073832 predicted 2299
2 SASI_Mm01_00073833 predicted 2534
3 SASI_Mm01_00073834 predicted 1958
4 SASI_Mm01_00073835 predicted 1490
5 SASI_Mm01_00073836 predicted 1843
6 SASI_Mm01_00073837 predicted 2622
7 SASI_Mm01_00073838 predicted 2245
8 SASI_Mm01_00073839 predicted 2386
9 SASI_Mm01_00073840 predicted 1320
10 SASI_Mm01_00073841 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019843
EIF4ENIF1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E nuclear import factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019843.3-726s21c1
Sequence:CCGGGGATCACCGTCTTAGCGATAACTCGAGTTATCGCTAAGACGGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019843.3-1172s21c1
Sequence:CCGGCATGCTTGGCTTCGATGATAGCTCGAGCTATCATCGAAGCCAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-1454s1c1
Sequence:CCGGGCCGTAACCAACAATCGACAACTCGAGTTGTCGATTGTTGGTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-836s1c1
Sequence:CCGGGAAGGTATAGTAGAGTGCAATCTCGAGATTGCACTCTACTATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019843.2-2968s1c1
Sequence:CCGGCGCCAAAGTTATCAGTGTAGACTCGAGTCTACACTGATAACTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019843.2-3156s1c1
Sequence:CCGGGCATTATGATGGAAGGATCTTCTCGAGAAGATCCTTCCATCATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019843.2-3201s1c1
Sequence:CCGGGTCTGAATACAGGATGCACAACTCGAGTTGTGCATCCTGTATTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019843.2-1675s1c1
Sequence:CCGGCAATCTTCTGAGTGGCCTTATCTCGAGATAAGGCCACTCAGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019843.2-3301s1c1
Sequence:CCGGCCTAAGGGTTCTGAGGAAATACTCGAGTATTTCCTCAGAACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-2159s1c1
Sequence:CCGGCGTAAGATGTACGAGAGCAAACTCGAGTTTGCTCTCGTACATCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019843
EIF4ENIF1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E nuclear import factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019843.3-726s21c1
Sequence:CCGGGGATCACCGTCTTAGCGATAACTCGAGTTATCGCTAAGACGGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019843.3-1172s21c1
Sequence:CCGGCATGCTTGGCTTCGATGATAGCTCGAGCTATCATCGAAGCCAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-1454s1c1
Sequence:CCGGGCCGTAACCAACAATCGACAACTCGAGTTGTCGATTGTTGGTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-836s1c1
Sequence:CCGGGAAGGTATAGTAGAGTGCAATCTCGAGATTGCACTCTACTATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019843.2-2968s1c1
Sequence:CCGGCGCCAAAGTTATCAGTGTAGACTCGAGTCTACACTGATAACTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019843.2-3156s1c1
Sequence:CCGGGCATTATGATGGAAGGATCTTCTCGAGAAGATCCTTCCATCATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019843.2-3201s1c1
Sequence:CCGGGTCTGAATACAGGATGCACAACTCGAGTTGTGCATCCTGTATTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019843.2-1675s1c1
Sequence:CCGGCAATCTTCTGAGTGGCCTTATCTCGAGATAAGGCCACTCAGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019843.2-3301s1c1
Sequence:CCGGCCTAAGGGTTCTGAGGAAATACTCGAGTATTTCCTCAGAACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-2159s1c1
Sequence:CCGGCGTAAGATGTACGAGAGCAAACTCGAGTTTGCTCTCGTACATCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019843
EIF4ENIF1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E nuclear import factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019843.3-726s21c1
Sequence:CCGGGGATCACCGTCTTAGCGATAACTCGAGTTATCGCTAAGACGGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019843.3-1172s21c1
Sequence:CCGGCATGCTTGGCTTCGATGATAGCTCGAGCTATCATCGAAGCCAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-1454s1c1
Sequence:CCGGGCCGTAACCAACAATCGACAACTCGAGTTGTCGATTGTTGGTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-836s1c1
Sequence:CCGGGAAGGTATAGTAGAGTGCAATCTCGAGATTGCACTCTACTATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019843.2-2968s1c1
Sequence:CCGGCGCCAAAGTTATCAGTGTAGACTCGAGTCTACACTGATAACTTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019843.2-3156s1c1
Sequence:CCGGGCATTATGATGGAAGGATCTTCTCGAGAAGATCCTTCCATCATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019843.2-3201s1c1
Sequence:CCGGGTCTGAATACAGGATGCACAACTCGAGTTGTGCATCCTGTATTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019843.2-1675s1c1
Sequence:CCGGCAATCTTCTGAGTGGCCTTATCTCGAGATAAGGCCACTCAGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019843.2-3301s1c1
Sequence:CCGGCCTAAGGGTTCTGAGGAAATACTCGAGTATTTCCTCAGAACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019843.2-2159s1c1
Sequence:CCGGCGTAAGATGTACGAGAGCAAACTCGAGTTTGCTCTCGTACATCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023743
VALIDATED
EIF4ENIF1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4E nuclear import factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023743.1-3108s21c1
Sequence:CCGGGCACACTATGTGAAGATGTTTCTCGAGAAACATCTTCACATAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-964s21c1
Sequence:CCGGCCCAGGAGAATTTGACTTTAACTCGAGTTAAAGTCAAATTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-3322s21c1
Sequence:CCGGCCTTATGTACAGACCTGTGTACTCGAGTACACAGGTCTGTACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-1019s21c1
Sequence:CCGGGCTTCGATGATAGAAGATGTTCTCGAGAACATCTTCTATCATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023743.1-3108s1c1
Sequence:CCGGGCACACTATGTGAAGATGTTTCTCGAGAAACATCTTCACATAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-1019s1c1
Sequence:CCGGGCTTCGATGATAGAAGATGTTCTCGAGAACATCTTCTATCATCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-964s1c1
Sequence:CCGGCCCAGGAGAATTTGACTTTAACTCGAGTTAAAGTCAAATTCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-2396s1c1
Sequence:CCGGGAACAAGATTATCGACCTAAACTCGAGTTTAGGTCGATAATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023743.1-3322s1c1
Sequence:CCGGCCTTATGTACAGACCTGTGTACTCGAGTACACAGGTCTGTACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023743
VALIDATED
EIF4ENIF1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4E nuclear import factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023743.1-3108s21c1
Sequence:CCGGGCACACTATGTGAAGATGTTTCTCGAGAAACATCTTCACATAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-964s21c1
Sequence:CCGGCCCAGGAGAATTTGACTTTAACTCGAGTTAAAGTCAAATTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-3322s21c1
Sequence:CCGGCCTTATGTACAGACCTGTGTACTCGAGTACACAGGTCTGTACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-1019s21c1
Sequence:CCGGGCTTCGATGATAGAAGATGTTCTCGAGAACATCTTCTATCATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023743.1-3108s1c1
Sequence:CCGGGCACACTATGTGAAGATGTTTCTCGAGAAACATCTTCACATAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-1019s1c1
Sequence:CCGGGCTTCGATGATAGAAGATGTTCTCGAGAACATCTTCTATCATCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-964s1c1
Sequence:CCGGCCCAGGAGAATTTGACTTTAACTCGAGTTAAAGTCAAATTCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-2396s1c1
Sequence:CCGGGAACAAGATTATCGACCTAAACTCGAGTTTAGGTCGATAATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023743.1-3322s1c1
Sequence:CCGGCCTTATGTACAGACCTGTGTACTCGAGTACACAGGTCTGTACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023743
VALIDATED
EIF4ENIF1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4E nuclear import factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023743.1-3108s21c1
Sequence:CCGGGCACACTATGTGAAGATGTTTCTCGAGAAACATCTTCACATAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-964s21c1
Sequence:CCGGCCCAGGAGAATTTGACTTTAACTCGAGTTAAAGTCAAATTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-3322s21c1
Sequence:CCGGCCTTATGTACAGACCTGTGTACTCGAGTACACAGGTCTGTACATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023743.1-1019s21c1
Sequence:CCGGGCTTCGATGATAGAAGATGTTCTCGAGAACATCTTCTATCATCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023743.1-3108s1c1
Sequence:CCGGGCACACTATGTGAAGATGTTTCTCGAGAAACATCTTCACATAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-1019s1c1
Sequence:CCGGGCTTCGATGATAGAAGATGTTCTCGAGAACATCTTCTATCATCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-964s1c1
Sequence:CCGGCCCAGGAGAATTTGACTTTAACTCGAGTTAAAGTCAAATTCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023743.1-2396s1c1
Sequence:CCGGGAACAAGATTATCGACCTAAACTCGAGTTTAGGTCGATAATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194361    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023743.1-3322s1c1
Sequence:CCGGCCTTATGTACAGACCTGTGTACTCGAGTACACAGGTCTGTACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks