EMAIL THIS PAGE TO A FRIEND

EIF4G1

eukaryotic translation initiation factor 4 gamma, 1

136 Gene Product Result for
Synonyms: EIF-4G1 EIF4F EIF4G EIF4GI P220 PARK18
Gene ID:
Human(1981) Summary: The protein encoded by this gene is a component of the multi-subunit protein complex EIF4F. This complex facilitates the recruitment of mRNA to the ribosome, which is a rate-limiting step during the initiation phase of protein synthesis. The recognition of the mRNA cap and the ATP-dependent unwinding of 5'-terminal secondary structure is catalyzed by factors in this complex. The subunit encoded by this gene is a large scaffolding protein that contains binding sites for other members of the EIF4F complex. A domain at its N-terminus can also interact with the poly(A)-binding protein, which may mediate the circularization of mRNA during translation. Alternative splicing results in multiple transcript variants, some of which are derived from alternative promoter usage. [provided by RefSeq, Aug 2010]
Mouse(208643) eukaryotic translation initiation factor 4, gamma 1
Rat(287986) eukaryotic translation initiation factor 4 gamma, 1
chicken(424953) eukaryotic translation initiation factor 4 gamma, 1
cow(444858) eukaryotic translation initiation factor 4 gamma, 1
Horse(100033975) eukaryotic translation initiation factor 4 gamma, 1
domestic cat(101085654) eukaryotic translation initiation factor 4 gamma, 1
dog(100688785) eukaryotic translation initiation factor 4 gamma, 1
naked mole-rat(101709881) eukaryotic translation initiation factor 4 gamma, 1
domestic guinea pig(100729118) eukaryotic translation initiation factor 4 gamma, 1
Domestic Rabbit(100009384) eukaryotic translation initiation factor 4 gamma, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500741 Anti-EIF4G antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4300582 Anti-EIF4G1 (Ab-1232) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1405750 Anti-EIF4G1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2100667 Anti-EIF4G1 antibody produced in rabbit affinity isolated antibody rat, human, mouse, rabbit, horse, rabbit, guinea pig
western blot pricing
HPA028487 Anti-EIF4G1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA043866 Anti-EIF4G1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4300268 Anti-phospho-EIF4G1 (pSer1232) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0001981M10 Monoclonal Anti-EIF4G1 antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB1403762 Monoclonal Anti-EIF4G1, (C-terminal) antibody produced in mouse clone 3A10, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_359230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004953 Rosetta Predictions human pricing
NM_182917 Rosetta Predictions human pricing
NM_198241 Rosetta Predictions human pricing
NM_198242 Rosetta Predictions human pricing
NM_198244 Rosetta Predictions human pricing
XM_001060756 Rosetta Predictions rat pricing
XM_213569 Rosetta Predictions rat pricing
NM_001005331 Rosetta Predictions mouse pricing
NM_145941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222596 predicted 1405
2 SASI_Hs01_00222597 predicted 1762
3 SASI_Hs01_00222599 predicted 2350
4 SASI_Hs02_00338631 predicted 682
5 SASI_Hs01_00222600 predicted 1578
6 SASI_Hs01_00222601 predicted 2963
7 SASI_Hs01_00222602 predicted 2085
8 SASI_Hs01_00222603 predicted 2618
9 SASI_Hs01_00222604 predicted 3552
10 SASI_Hs01_00222605 predicted 3561
11 SASI_Hs01_00222598 predicted 3737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202797 predicted 2182
2 SASI_Hs01_00202798 predicted 2542
3 SASI_Hs01_00202800 predicted 3135
4 SASI_Hs02_00371033 predicted 1457
5 SASI_Hs01_00202801 predicted 2352
6 SASI_Hs01_00202802 predicted 3741
7 SASI_Hs01_00202803 predicted 2866
8 SASI_Hs01_00202804 predicted 3394
9 SASI_Hs01_00202805 predicted 4329
10 SASI_Hs01_00202806 predicted 4337
11 SASI_Hs01_00202799 predicted 4229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165004 predicted 1983
2 SASI_Hs01_00165005 predicted 2343
3 SASI_Hs01_00165007 predicted 2933
4 SASI_Hs02_00371777 predicted 1255
5 SASI_Hs01_00165008 predicted 2159
6 SASI_Hs01_00165009 predicted 3544
7 SASI_Hs01_00165010 predicted 2667
8 SASI_Hs01_00165011 predicted 3198
9 SASI_Hs01_00165012 predicted 4133
10 SASI_Hs01_00165013 predicted 4136
11 SASI_Hs01_00165006 predicted 4155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026354 predicted 1575
2 SASI_Hs01_00026355 predicted 1928
3 SASI_Hs01_00026357 predicted 2520
4 SASI_Hs02_00371778 predicted 839
5 SASI_Hs01_00026358 predicted 1737
6 SASI_Hs01_00026359 predicted 3129
7 SASI_Hs01_00026360 predicted 2248
8 SASI_Hs01_00026361 predicted 2777
9 SASI_Hs01_00026362 predicted 3713
10 SASI_Hs01_00026363 predicted 3722
11 SASI_Hs01_00026356 predicted 3733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047818 predicted 1745
2 SASI_Hs01_00047819 predicted 2110
3 SASI_Hs01_00047821 predicted 2690
4 SASI_Hs02_00371781 predicted 1023
5 SASI_Hs01_00047822 predicted 1918
6 SASI_Hs01_00047823 predicted 3304
7 SASI_Hs01_00047824 predicted 2425
8 SASI_Hs01_00047825 predicted 2954
9 SASI_Hs01_00047826 predicted 3892
10 SASI_Hs01_00047827 predicted 3897
11 SASI_Hs01_00047820 predicted 3908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297621 predicted 4687
2 SASI_Rn02_00297622 predicted 1949
3 SASI_Rn02_00297623 predicted 1332
4 SASI_Rn02_00297624 predicted 2028
5 SASI_Rn02_00297625 predicted 4674
6 SASI_Rn02_00297626 predicted 1138
7 SASI_Rn02_00297627 predicted 4243
8 SASI_Rn02_00297628 predicted 4645
9 SASI_Rn02_00297629 predicted 588
10 SASI_Rn02_00297630 predicted 3637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374736 predicted 4684
2 SASI_Rn02_00374737 predicted 1949
3 SASI_Rn02_00374738 predicted 1332
4 SASI_Rn02_00374739 predicted 2023
5 SASI_Rn02_00374740 predicted 4669
6 SASI_Rn02_00374741 predicted 1142
7 SASI_Rn02_00374742 predicted 4238
8 SASI_Rn02_00374743 predicted 4647
9 SASI_Rn02_00374744 predicted 585
10 SASI_Rn02_00374745 predicted 3641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143564 predicted 4588
2 SASI_Mm01_00143565 predicted 2135
3 SASI_Mm01_00143566 predicted 1095
4 SASI_Mm01_00143567 predicted 4166
5 SASI_Mm01_00143568 predicted 673
6 SASI_Mm01_00143569 predicted 4152
7 SASI_Mm01_00143570 predicted 1021
8 SASI_Mm01_00143571 predicted 1237
9 SASI_Mm01_00143572 predicted 4077
10 SASI_Mm01_00143573 predicted 3883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140019 predicted 4615
2 SASI_Mm01_00140020 predicted 2160
3 SASI_Mm01_00140021 predicted 1119
4 SASI_Mm01_00140022 predicted 4195
5 SASI_Mm01_00140023 predicted 690
6 SASI_Mm01_00140024 predicted 4173
7 SASI_Mm01_00140025 predicted 1045
8 SASI_Mm01_00140026 predicted 1252
9 SASI_Mm01_00140027 predicted 4100
10 SASI_Mm01_00140028 predicted 3904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359230
VALIDATED
EIF4G1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_359230.1-2097s1c1
Sequence:CCGGGCGATGTGTCTTGAGCTAATACTCGAGTATTAGCTCAAGACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359230.1-1617s1c1
Sequence:CCGGCCCTCATGACAACTGTCTGTTCTCGAGAACAGACAGTTGTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359230.1-1129s1c1
Sequence:CCGGGCTGTATGAAACACTAGAATTCTCGAGAATTCTAGTGTTTCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359230.1-1802s1c1
Sequence:CCGGCGGATGTTCTTTGATGCTCTACTCGAGTAGAGCATCAAAGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359230.1-227s1c1
Sequence:CCGGCACCGAGAACATATTAAAGTACTCGAGTACTTTAATATGTTCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359230
VALIDATED
EIF4G1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_359230.1-2097s1c1
Sequence:CCGGGCGATGTGTCTTGAGCTAATACTCGAGTATTAGCTCAAGACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359230.1-1617s1c1
Sequence:CCGGCCCTCATGACAACTGTCTGTTCTCGAGAACAGACAGTTGTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359230.1-1129s1c1
Sequence:CCGGGCTGTATGAAACACTAGAATTCTCGAGAATTCTAGTGTTTCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359230.1-1802s1c1
Sequence:CCGGCGGATGTTCTTTGATGCTCTACTCGAGTAGAGCATCAAAGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359230.1-227s1c1
Sequence:CCGGCACCGAGAACATATTAAAGTACTCGAGTACTTTAATATGTTCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359230
VALIDATED
EIF4G1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_359230.1-2097s1c1
Sequence:CCGGGCGATGTGTCTTGAGCTAATACTCGAGTATTAGCTCAAGACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359230.1-1617s1c1
Sequence:CCGGCCCTCATGACAACTGTCTGTTCTCGAGAACAGACAGTTGTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359230.1-1129s1c1
Sequence:CCGGGCTGTATGAAACACTAGAATTCTCGAGAATTCTAGTGTTTCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359230.1-1802s1c1
Sequence:CCGGCGGATGTTCTTTGATGCTCTACTCGAGTAGAGCATCAAAGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359230.1-227s1c1
Sequence:CCGGCACCGAGAACATATTAAAGTACTCGAGTACTTTAATATGTTCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182917
VALIDATED
EIF4G1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-676s1c1
Sequence:CCGGCCCTACAGAATTTGGGACCTACTCGAGTAGGTCCCAAATTCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_182917.2-4687s1c1
Sequence:CCGGGCAGATAGTATCCAACACGTTCTCGAGAACGTGTTGGATACTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-528s1c1
Sequence:CCGGCCCAAGTAATGATGATCCCTTCTCGAGAAGGGATCATCATTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-3616s1c1
Sequence:CCGGCCCAGCTACTAGTACTTTGAACTCGAGTTCAAAGTACTAGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_182917.2-4862s1c1
Sequence:CCGGGCCCTTGTAGTGACCTTAGAACTCGAGTTCTAAGGTCACTACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-3081s21c1
Sequence:CCGGCTTTAGGGAATATCAAGTTTACTCGAGTAAACTTGATATTCCCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-2551s21c1
Sequence:CCGGAGTGTTAATGACCGAAGATATCTCGAGATATCTTCGGTCATTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182917.3-5308s21c1
Sequence:CCGGGTGATGTGTCTGAACTAATAACTCGAGTTATTAGTTCAGACACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-3310s21c1
Sequence:CCGGGTCATCCCGCATCCGCTTTATCTCGAGATAAAGCGGATGCGGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-4853s21c1
Sequence:CCGGGTCTGCTATTCTGCAATTATTCTCGAGAATAATTGCAGAATAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182917
VALIDATED
EIF4G1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-676s1c1
Sequence:CCGGCCCTACAGAATTTGGGACCTACTCGAGTAGGTCCCAAATTCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_182917.2-4687s1c1
Sequence:CCGGGCAGATAGTATCCAACACGTTCTCGAGAACGTGTTGGATACTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-528s1c1
Sequence:CCGGCCCAAGTAATGATGATCCCTTCTCGAGAAGGGATCATCATTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-3616s1c1
Sequence:CCGGCCCAGCTACTAGTACTTTGAACTCGAGTTCAAAGTACTAGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_182917.2-4862s1c1
Sequence:CCGGGCCCTTGTAGTGACCTTAGAACTCGAGTTCTAAGGTCACTACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-3081s21c1
Sequence:CCGGCTTTAGGGAATATCAAGTTTACTCGAGTAAACTTGATATTCCCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-2551s21c1
Sequence:CCGGAGTGTTAATGACCGAAGATATCTCGAGATATCTTCGGTCATTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182917.3-5308s21c1
Sequence:CCGGGTGATGTGTCTGAACTAATAACTCGAGTTATTAGTTCAGACACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-3310s21c1
Sequence:CCGGGTCATCCCGCATCCGCTTTATCTCGAGATAAAGCGGATGCGGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-4853s21c1
Sequence:CCGGGTCTGCTATTCTGCAATTATTCTCGAGAATAATTGCAGAATAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182917
VALIDATED
EIF4G1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-676s1c1
Sequence:CCGGCCCTACAGAATTTGGGACCTACTCGAGTAGGTCCCAAATTCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_182917.2-4687s1c1
Sequence:CCGGGCAGATAGTATCCAACACGTTCTCGAGAACGTGTTGGATACTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-528s1c1
Sequence:CCGGCCCAAGTAATGATGATCCCTTCTCGAGAAGGGATCATCATTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182917.2-3616s1c1
Sequence:CCGGCCCAGCTACTAGTACTTTGAACTCGAGTTCAAAGTACTAGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_182917.2-4862s1c1
Sequence:CCGGGCCCTTGTAGTGACCTTAGAACTCGAGTTCTAAGGTCACTACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-3081s21c1
Sequence:CCGGCTTTAGGGAATATCAAGTTTACTCGAGTAAACTTGATATTCCCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-2551s21c1
Sequence:CCGGAGTGTTAATGACCGAAGATATCTCGAGATATCTTCGGTCATTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182917.3-5308s21c1
Sequence:CCGGGTGATGTGTCTGAACTAATAACTCGAGTTATTAGTTCAGACACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-3310s21c1
Sequence:CCGGGTCATCCCGCATCCGCTTTATCTCGAGATAAAGCGGATGCGGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182917.3-4853s21c1
Sequence:CCGGGTCTGCTATTCTGCAATTATTCTCGAGAATAATTGCAGAATAGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145941
EIF4G1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4604s21c1
Sequence:CCGGCCCTCATGACAACTGTCTGTTCTCGAGAACAGACAGTTGTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4789s21c1
Sequence:CCGGCGGATGTTCTTTGATGCTCTACTCGAGTAGAGCATCAAAGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145941.2-5084s21c1
Sequence:CCGGGCGATGTGTCTTGAGCTAATACTCGAGTATTAGCTCAAGACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4116s21c1
Sequence:CCGGGCTGTATGAAACACTAGAATTCTCGAGAATTCTAGTGTTTCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-3214s21c1
Sequence:CCGGCACCGAGAACATATTAAAGTACTCGAGTACTTTAATATGTTCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145941
EIF4G1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4604s21c1
Sequence:CCGGCCCTCATGACAACTGTCTGTTCTCGAGAACAGACAGTTGTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4789s21c1
Sequence:CCGGCGGATGTTCTTTGATGCTCTACTCGAGTAGAGCATCAAAGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145941.2-5084s21c1
Sequence:CCGGGCGATGTGTCTTGAGCTAATACTCGAGTATTAGCTCAAGACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4116s21c1
Sequence:CCGGGCTGTATGAAACACTAGAATTCTCGAGAATTCTAGTGTTTCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-3214s21c1
Sequence:CCGGCACCGAGAACATATTAAAGTACTCGAGTACTTTAATATGTTCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145941
EIF4G1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4604s21c1
Sequence:CCGGCCCTCATGACAACTGTCTGTTCTCGAGAACAGACAGTTGTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4789s21c1
Sequence:CCGGCGGATGTTCTTTGATGCTCTACTCGAGTAGAGCATCAAAGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145941.2-5084s21c1
Sequence:CCGGGCGATGTGTCTTGAGCTAATACTCGAGTATTAGCTCAAGACACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-4116s21c1
Sequence:CCGGGCTGTATGAAACACTAGAATTCTCGAGAATTCTAGTGTTTCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145941.2-3214s21c1
Sequence:CCGGCACCGAGAACATATTAAAGTACTCGAGTACTTTAATATGTTCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks