EMAIL THIS PAGE TO A FRIEND

EIF4G2

eukaryotic translation initiation factor 4 gamma, 2

162 Gene Product Result for
Synonyms: AAG1 DAP5 NAT1 P97
Gene ID:
Human(1982) Summary: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G that contains the binding sites for eIF4A and eIF3; eIF4G, in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G, which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. In vitro and in vivo studies indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(13690) eukaryotic translation initiation factor 4, gamma 2
Rat(361628) eukaryotic translation initiation factor 4, gamma 2
sheep(101123232) eukaryotic translation initiation factor 4 gamma, 2
Domestic Rabbit(100009236) eukaryotic translation initiation factor 4 gamma, 2
domestic guinea pig(100728504) eukaryotic translation initiation factor 4 gamma, 2
naked mole-rat(101704822) eukaryotic translation initiation factor 4 gamma, 2
fruit fly(42819) eukaryotic translation initiation factor 4G2
dog(476854) eukaryotic translation initiation factor 4 gamma, 2
chicken(395905) eukaryotic translation initiation factor 4 gamma, 2
domestic cat(101089295) eukaryotic translation initiation factor 4 gamma, 2
cow(286870) eukaryotic translation initiation factor 4 gamma, 2
Horse(100071378) eukaryotic translation initiation factor 4 gamma, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001418 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042559 Rosetta Predictions human pricing
NM_001418 Rosetta Predictions human pricing
NM_001017374 Rosetta Predictions rat pricing
NM_001040131 Rosetta Predictions mouse pricing
NM_013507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310578 predicted 2742
2 SASI_Hs02_00310579 predicted 1377
3 SASI_Hs02_00310580 predicted 1002
4 SASI_Hs02_00310581 predicted 896
5 SASI_Hs02_00310582 predicted 2732
6 SASI_Hs02_00310583 predicted 645
7 SASI_Hs02_00310584 predicted 1912
8 SASI_Hs02_00310585 predicted 558
9 SASI_Hs02_00310586 predicted 775
10 SASI_Hs02_00310587 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183542 predicted 2863
2 SASI_Hs01_00183543 predicted 1376
3 SASI_Hs02_00331821 predicted 1007
4 SASI_Hs02_00331822 predicted 900
5 SASI_Hs01_00183545 predicted 2846
6 SASI_Hs01_00183546 predicted 645
7 SASI_Hs01_00183547 predicted 2027
8 SASI_Hs01_00183549 predicted 559
9 SASI_Hs01_00183550 predicted 782
10 SASI_Hs01_00183551 predicted 601
11 SASI_Hs01_00183544 predicted 2595
12 SASI_Hs01_00183548 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202192 predicted 2353
2 SASI_Rn02_00202193 predicted 890
3 SASI_Rn02_00202194 predicted 2592
4 SASI_Rn02_00202195 predicted 2586
5 SASI_Rn02_00202196 predicted 1131
6 SASI_Rn02_00202197 predicted 1453
7 SASI_Rn02_00202198 predicted 2575
8 SASI_Rn02_00202199 predicted 531
9 SASI_Rn02_00202200 predicted 2466
10 SASI_Rn02_00202201 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290286 predicted 2665
2 SASI_Mm02_00290287 predicted 695
3 SASI_Mm02_00290288 predicted 812
4 SASI_Mm02_00290289 predicted 1167
5 SASI_Mm02_00290290 predicted 519
6 SASI_Mm02_00290291 predicted 2495
7 SASI_Mm02_00290292 predicted 2918
8 SASI_Mm02_00290293 predicted 1174
9 SASI_Mm02_00290294 predicted 699
10 SASI_Mm02_00290295 predicted 2535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322169 predicted 2777
2 SASI_Mm01_00183886 predicted 688
3 SASI_Mm01_00183887 predicted 812
4 SASI_Mm01_00183888 predicted 1161
5 SASI_Mm02_00322170 predicted 520
6 SASI_Mm01_00183890 predicted 2609
7 SASI_Mm01_00183892 predicted 3033
8 SASI_Mm02_00322171 predicted 1172
9 SASI_Mm01_00183893 predicted 701
10 SASI_Mm02_00322172 predicted 2652
11 SASI_Mm01_00183889 predicted 1497
12 SASI_Mm01_00183891 predicted 573
13 SASI_Mm01_00183894 predicted 2511
14 SASI_Mm01_00183895 predicted 1726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001418
VALIDATED
EIF4G2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1260s21c1
Sequence:CCGGGTGCTCCTTGATGTTAAGTAACTCGAGTTACTTAACATCAAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-2325s21c1
Sequence:CCGGCCCTTTGGTGAAATCCTATTTCTCGAGAAATAGGATTTCACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1370s21c1
Sequence:CCGGATGGACCAAAGACGATCAATCCTCGAGGATTGATCGTCTTTGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-3480s21c1
Sequence:CCGGGCAACACTGAATACTGTAGAACTCGAGTTCTACAGTATTCAGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1609s21c1
Sequence:CCGGATGGGACGTCATCGTTCAAATCTCGAGATTTGAACGATGACGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-2214s1c1
Sequence:CCGGCCCTTTGGTGAAATCCTATTTCTCGAGAAATAGGATTTCACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001418.1-682s1c1
Sequence:CCGGCCAAAGTATAGCTCACTGTATCTCGAGATACAGTGAGCTATACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-3369s1c1
Sequence:CCGGGCAACACTGAATACTGTAGAACTCGAGTTCTACAGTATTCAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001418.1-3039s1c1
Sequence:CCGGCCAAAGCCTTAAATTGTGCAACTCGAGTTGCACAATTTAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-1149s1c1
Sequence:CCGGGTGCTCCTTGATGTTAAGTAACTCGAGTTACTTAACATCAAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001418
VALIDATED
EIF4G2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1260s21c1
Sequence:CCGGGTGCTCCTTGATGTTAAGTAACTCGAGTTACTTAACATCAAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-2325s21c1
Sequence:CCGGCCCTTTGGTGAAATCCTATTTCTCGAGAAATAGGATTTCACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1370s21c1
Sequence:CCGGATGGACCAAAGACGATCAATCCTCGAGGATTGATCGTCTTTGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-3480s21c1
Sequence:CCGGGCAACACTGAATACTGTAGAACTCGAGTTCTACAGTATTCAGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1609s21c1
Sequence:CCGGATGGGACGTCATCGTTCAAATCTCGAGATTTGAACGATGACGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-2214s1c1
Sequence:CCGGCCCTTTGGTGAAATCCTATTTCTCGAGAAATAGGATTTCACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001418.1-682s1c1
Sequence:CCGGCCAAAGTATAGCTCACTGTATCTCGAGATACAGTGAGCTATACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-3369s1c1
Sequence:CCGGGCAACACTGAATACTGTAGAACTCGAGTTCTACAGTATTCAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001418.1-3039s1c1
Sequence:CCGGCCAAAGCCTTAAATTGTGCAACTCGAGTTGCACAATTTAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-1149s1c1
Sequence:CCGGGTGCTCCTTGATGTTAAGTAACTCGAGTTACTTAACATCAAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001418
VALIDATED
EIF4G2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1260s21c1
Sequence:CCGGGTGCTCCTTGATGTTAAGTAACTCGAGTTACTTAACATCAAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-2325s21c1
Sequence:CCGGCCCTTTGGTGAAATCCTATTTCTCGAGAAATAGGATTTCACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1370s21c1
Sequence:CCGGATGGACCAAAGACGATCAATCCTCGAGGATTGATCGTCTTTGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-3480s21c1
Sequence:CCGGGCAACACTGAATACTGTAGAACTCGAGTTCTACAGTATTCAGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001418.3-1609s21c1
Sequence:CCGGATGGGACGTCATCGTTCAAATCTCGAGATTTGAACGATGACGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-2214s1c1
Sequence:CCGGCCCTTTGGTGAAATCCTATTTCTCGAGAAATAGGATTTCACCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001418.1-682s1c1
Sequence:CCGGCCAAAGTATAGCTCACTGTATCTCGAGATACAGTGAGCTATACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-3369s1c1
Sequence:CCGGGCAACACTGAATACTGTAGAACTCGAGTTCTACAGTATTCAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001418.1-3039s1c1
Sequence:CCGGCCAAAGCCTTAAATTGTGCAACTCGAGTTGCACAATTTAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001418.1-1149s1c1
Sequence:CCGGGTGCTCCTTGATGTTAAGTAACTCGAGTTACTTAACATCAAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013507
VALIDATED
EIF4G2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-2513s21c1
Sequence:CCGGCCCACTCCTTAAATTGGAGAACTCGAGTTCTCCAATTTAAGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013507.3-696s21c1
Sequence:CCGGGCCTTAGAAGAGCCAAAGTATCTCGAGATACTTTGGCTCTTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-519s21c1
Sequence:CCGGGCAGCAAACAACTCCGCAAATCTCGAGATTTGCGGAGTTGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-3351s21c1
Sequence:CCGGGCCAGTTACCATAGGCTGTTTCTCGAGAAACAGCCTATGGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013507.3-1941s21c1
Sequence:CCGGCCACCATCAAAGGAAGAACTACTCGAGTAGTTCTTCCTTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-3351s1c1
Sequence:CCGGGCCAGTTACCATAGGCTGTTTCTCGAGAAACAGCCTATGGTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013507.2-519s1c1
Sequence:CCGGGCAGCAAACAACTCCGCAAATCTCGAGATTTGCGGAGTTGTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013507.2-1941s1c1
Sequence:CCGGCCACCATCAAAGGAAGAACTACTCGAGTAGTTCTTCCTTTGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-696s1c1
Sequence:CCGGGCCTTAGAAGAGCCAAAGTATCTCGAGATACTTTGGCTCTTCTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-2513s1c1
Sequence:CCGGCCCACTCCTTAAATTGGAGAACTCGAGTTCTCCAATTTAAGGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013507
VALIDATED
EIF4G2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-2513s21c1
Sequence:CCGGCCCACTCCTTAAATTGGAGAACTCGAGTTCTCCAATTTAAGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013507.3-696s21c1
Sequence:CCGGGCCTTAGAAGAGCCAAAGTATCTCGAGATACTTTGGCTCTTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-519s21c1
Sequence:CCGGGCAGCAAACAACTCCGCAAATCTCGAGATTTGCGGAGTTGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-3351s21c1
Sequence:CCGGGCCAGTTACCATAGGCTGTTTCTCGAGAAACAGCCTATGGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013507.3-1941s21c1
Sequence:CCGGCCACCATCAAAGGAAGAACTACTCGAGTAGTTCTTCCTTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-3351s1c1
Sequence:CCGGGCCAGTTACCATAGGCTGTTTCTCGAGAAACAGCCTATGGTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013507.2-519s1c1
Sequence:CCGGGCAGCAAACAACTCCGCAAATCTCGAGATTTGCGGAGTTGTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013507.2-1941s1c1
Sequence:CCGGCCACCATCAAAGGAAGAACTACTCGAGTAGTTCTTCCTTTGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-696s1c1
Sequence:CCGGGCCTTAGAAGAGCCAAAGTATCTCGAGATACTTTGGCTCTTCTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-2513s1c1
Sequence:CCGGCCCACTCCTTAAATTGGAGAACTCGAGTTCTCCAATTTAAGGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013507
VALIDATED
EIF4G2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-2513s21c1
Sequence:CCGGCCCACTCCTTAAATTGGAGAACTCGAGTTCTCCAATTTAAGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013507.3-696s21c1
Sequence:CCGGGCCTTAGAAGAGCCAAAGTATCTCGAGATACTTTGGCTCTTCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-519s21c1
Sequence:CCGGGCAGCAAACAACTCCGCAAATCTCGAGATTTGCGGAGTTGTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013507.3-3351s21c1
Sequence:CCGGGCCAGTTACCATAGGCTGTTTCTCGAGAAACAGCCTATGGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013507.3-1941s21c1
Sequence:CCGGCCACCATCAAAGGAAGAACTACTCGAGTAGTTCTTCCTTTGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-3351s1c1
Sequence:CCGGGCCAGTTACCATAGGCTGTTTCTCGAGAAACAGCCTATGGTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013507.2-519s1c1
Sequence:CCGGGCAGCAAACAACTCCGCAAATCTCGAGATTTGCGGAGTTGTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013507.2-1941s1c1
Sequence:CCGGCCACCATCAAAGGAAGAACTACTCGAGTAGTTCTTCCTTTGATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-696s1c1
Sequence:CCGGGCCTTAGAAGAGCCAAAGTATCTCGAGATACTTTGGCTCTTCTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013507.2-2513s1c1
Sequence:CCGGCCCACTCCTTAAATTGGAGAACTCGAGTTCTCCAATTTAAGGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks