EMAIL THIS PAGE TO A FRIEND

EIF4G3

eukaryotic translation initiation factor 4 gamma, 3

100 Gene Product Result for
Synonyms: eIF-4G 3 eIF4G 3 eIF4GII
UniProtKB ID: O43432, B9EGQ7, Q15597, Q5SWC3, Q8NEN1
Gene ID:
Mouse(230861) eukaryotic translation initiation factor 4 gamma, 3
Rat(298573) eukaryotic translation initiation factor 4 gamma, 3
Zebrafish(566131) eukaryotic translation initiation factor 4 gamma, 3
cow(534618) eukaryotic translation initiation factor 4 gamma, 3
Horse(791239) eukaryotic translation initiation factor 4 gamma, 3
dog(478202) eukaryotic translation initiation factor 4 gamma, 3
domestic cat(101093533) eukaryotic translation initiation factor 4 gamma, 3
chicken(425544) eukaryotic translation initiation factor 4 gamma, 3
domestic guinea pig(100726207) eukaryotic translation initiation factor 4 gamma, 3
naked mole-rat(101722200) eukaryotic translation initiation factor 4 gamma, 3
sheep(101105220) eukaryotic translation initiation factor 4 gamma, 3
Domestic Rabbit(100341364) eukaryotic translation initiation factor 4 gamma, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411985 ANTI-EIF4G3 antibody produced in mouse clone 1D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV40487 Anti-EIF4G3 antibody produced in rabbit affinity isolated antibody rat, guinea pig, horse, bovine, mouse, rabbit, human
western blot pricing
HPA025031 Anti-EIF4G3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry pricing
HPA025039 Anti-EIF4G3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry pricing
HPA025041 Anti-EIF4G3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunohistochemistry pricing
SAB2100669 Anti-EIF4G3 antibody produced in rabbit affinity isolated antibody canine, mouse, guinea pig, rat, horse, rabbit, human, bovine
western blot pricing
WH0008672M1 Monoclonal Anti-EIF4G3 antibody produced in mouse clone 1B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404613 Monoclonal Anti-EIF4G3 antibody produced in mouse clone 1H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074971 MISSION® esiRNA esiRNA human EIF4G3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003760 Rosetta Predictions human pricing
NM_001106693 Rosetta Predictions rat pricing
NM_172703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019883 predicted 5149
2 SASI_Hs01_00019884 predicted 4952
3 SASI_Hs01_00019886 predicted 916
4 SASI_Hs02_00336238 predicted 5119
5 SASI_Hs02_00336239 predicted 2415
6 SASI_Hs01_00019888 predicted 3512
7 SASI_Hs01_00019890 predicted 2304
8 SASI_Hs01_00019891 predicted 4247
9 SASI_Hs02_00336240 predicted 711
10 SASI_Hs02_00336241 predicted 4909
11 SASI_Hs01_00019882 predicted 2642
12 SASI_Hs01_00019885 predicted 3100
13 SASI_Hs01_00019887 predicted 4536
14 SASI_Hs01_00019889 predicted 4271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221458 predicted 4049
2 SASI_Rn02_00221459 predicted 2623
3 SASI_Rn02_00221460 predicted 2014
4 SASI_Rn02_00221461 predicted 3147
5 SASI_Rn02_00221462 predicted 4558
6 SASI_Rn02_00221463 predicted 2922
7 SASI_Rn02_00221464 predicted 386
8 SASI_Rn02_00221465 predicted 4674
9 SASI_Rn02_00221466 predicted 4245
10 SASI_Rn02_00221467 predicted 4318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059746 predicted 4977
2 SASI_Mm01_00059747 predicted 3174
3 SASI_Mm01_00059748 predicted 4833
4 SASI_Mm01_00059749 predicted 2881
5 SASI_Mm01_00059750 predicted 4467
6 SASI_Mm01_00059751 predicted 3950
7 SASI_Mm01_00059752 predicted 2086
8 SASI_Mm01_00059753 predicted 2828
9 SASI_Mm01_00059754 predicted 4875
10 SASI_Mm01_00059755 predicted 4532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003760
VALIDATED
EIF4G3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003760.2-5387s1c1
Sequence:CCGGGCAGTTTCTGTAAACAACTGTCTCGAGACAGTTGTTTACAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003760.2-1271s1c1
Sequence:CCGGCCCTGTAGTGTAGCACCTAATCTCGAGATTAGGTGCTACACTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003760.2-5356s1c1
Sequence:CCGGGACTGCAAATGCCAGTGTAATCTCGAGATTACACTGGCATTTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003760.2-692s1c1
Sequence:CCGGGATCCAAACCAGGGAGGTAAACTCGAGTTTACCTCCCTGGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_003760.2-5560s1c1
Sequence:CCGGCCTCTCAGCTTGCTTCAGAAACTCGAGTTTCTGAAGCAAGCTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003760.2-2376s1c1
Sequence:CCGGGCCAAAGAAGAGAACCCAGAACTCGAGTTCTGGGTTCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003760.2-2696s1c1
Sequence:CCGGCGATGTCTAGTAACGCTGAAACTCGAGTTTCAGCGTTACTAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-5120s21c1
Sequence:GTACCGGACTACAAGCATCGATAGTAAACTCGAGTTTACTATCGATGCTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-3421s21c1
Sequence:CCGGCACGTATGGACCAGTACTTTACTCGAGTAAAGTACTGGTCCATACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-2937s21c1
Sequence:CCGGGAGCGGCTGAAAGGAGTTATTCTCGAGAATAACTCCTTTCAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-1440s21c1
Sequence:CCGGCTTAGTAGCCAACCAATATTCCTCGAGGAATATTGGTTGGCTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003760
VALIDATED
EIF4G3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003760.2-5387s1c1
Sequence:CCGGGCAGTTTCTGTAAACAACTGTCTCGAGACAGTTGTTTACAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003760.2-1271s1c1
Sequence:CCGGCCCTGTAGTGTAGCACCTAATCTCGAGATTAGGTGCTACACTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003760.2-5356s1c1
Sequence:CCGGGACTGCAAATGCCAGTGTAATCTCGAGATTACACTGGCATTTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003760.2-692s1c1
Sequence:CCGGGATCCAAACCAGGGAGGTAAACTCGAGTTTACCTCCCTGGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_003760.2-5560s1c1
Sequence:CCGGCCTCTCAGCTTGCTTCAGAAACTCGAGTTTCTGAAGCAAGCTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003760.2-2376s1c1
Sequence:CCGGGCCAAAGAAGAGAACCCAGAACTCGAGTTCTGGGTTCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003760.2-2696s1c1
Sequence:CCGGCGATGTCTAGTAACGCTGAAACTCGAGTTTCAGCGTTACTAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-5120s21c1
Sequence:GTACCGGACTACAAGCATCGATAGTAAACTCGAGTTTACTATCGATGCTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-3421s21c1
Sequence:CCGGCACGTATGGACCAGTACTTTACTCGAGTAAAGTACTGGTCCATACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-2937s21c1
Sequence:CCGGGAGCGGCTGAAAGGAGTTATTCTCGAGAATAACTCCTTTCAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-1440s21c1
Sequence:CCGGCTTAGTAGCCAACCAATATTCCTCGAGGAATATTGGTTGGCTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003760
VALIDATED
EIF4G3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003760.2-5387s1c1
Sequence:CCGGGCAGTTTCTGTAAACAACTGTCTCGAGACAGTTGTTTACAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003760.2-1271s1c1
Sequence:CCGGCCCTGTAGTGTAGCACCTAATCTCGAGATTAGGTGCTACACTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003760.2-5356s1c1
Sequence:CCGGGACTGCAAATGCCAGTGTAATCTCGAGATTACACTGGCATTTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003760.2-692s1c1
Sequence:CCGGGATCCAAACCAGGGAGGTAAACTCGAGTTTACCTCCCTGGTTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_003760.2-5560s1c1
Sequence:CCGGCCTCTCAGCTTGCTTCAGAAACTCGAGTTTCTGAAGCAAGCTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003760.2-2376s1c1
Sequence:CCGGGCCAAAGAAGAGAACCCAGAACTCGAGTTCTGGGTTCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003760.2-2696s1c1
Sequence:CCGGCGATGTCTAGTAACGCTGAAACTCGAGTTTCAGCGTTACTAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-5120s21c1
Sequence:GTACCGGACTACAAGCATCGATAGTAAACTCGAGTTTACTATCGATGCTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-3421s21c1
Sequence:CCGGCACGTATGGACCAGTACTTTACTCGAGTAAAGTACTGGTCCATACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-2937s21c1
Sequence:CCGGGAGCGGCTGAAAGGAGTTATTCTCGAGAATAACTCCTTTCAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003760.3-1440s21c1
Sequence:CCGGCTTAGTAGCCAACCAATATTCCTCGAGGAATATTGGTTGGCTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172703
VALIDATED
EIF4G3 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4 gamma, 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172703.2-2675s1c1
Sequence:CCGGCACTTGAGAAAGGCGGAGAATCTCGAGATTCTCCGCCTTTCTCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172703.2-4119s1c1
Sequence:CCGGCCAAGTCTATCATTGACGAATCTCGAGATTCGTCAATGATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172703.2-5365s1c1
Sequence:CCGGCCTGGAACAAGGAAACAGCAACTCGAGTTGCTGTTTCCTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172703.2-1873s1c1
Sequence:CCGGCCTGAGAACTTGCCTTAGCAACTCGAGTTGCTAAGGCAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-3342s21c1
Sequence:CCGGCACGCATGGACCAGTACTTTACTCGAGTAAAGTACTGGTCCATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-1538s21c1
Sequence:CCGGCCTCATGATAGTCAGCTAATTCTCGAGAATTAGCTGACTATCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-2309s21c1
Sequence:CCGGGGGCTCACCTTCCCGTTTAAACTCGAGTTTAAACGGGAAGGTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172703.2-5342s21c1
Sequence:CCGGAGGTGATCATGGAGGATAAAGCTCGAGCTTTATCCTCCATGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-4981s21c1
Sequence:CCGGACTACAAGCATCCATAGTAAACTCGAGTTTACTATGGATGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172703
VALIDATED
EIF4G3 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4 gamma, 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172703.2-2675s1c1
Sequence:CCGGCACTTGAGAAAGGCGGAGAATCTCGAGATTCTCCGCCTTTCTCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172703.2-4119s1c1
Sequence:CCGGCCAAGTCTATCATTGACGAATCTCGAGATTCGTCAATGATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172703.2-5365s1c1
Sequence:CCGGCCTGGAACAAGGAAACAGCAACTCGAGTTGCTGTTTCCTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172703.2-1873s1c1
Sequence:CCGGCCTGAGAACTTGCCTTAGCAACTCGAGTTGCTAAGGCAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-3342s21c1
Sequence:CCGGCACGCATGGACCAGTACTTTACTCGAGTAAAGTACTGGTCCATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-1538s21c1
Sequence:CCGGCCTCATGATAGTCAGCTAATTCTCGAGAATTAGCTGACTATCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-2309s21c1
Sequence:CCGGGGGCTCACCTTCCCGTTTAAACTCGAGTTTAAACGGGAAGGTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172703.2-5342s21c1
Sequence:CCGGAGGTGATCATGGAGGATAAAGCTCGAGCTTTATCCTCCATGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-4981s21c1
Sequence:CCGGACTACAAGCATCCATAGTAAACTCGAGTTTACTATGGATGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172703
VALIDATED
EIF4G3 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4 gamma, 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172703.2-2675s1c1
Sequence:CCGGCACTTGAGAAAGGCGGAGAATCTCGAGATTCTCCGCCTTTCTCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172703.2-4119s1c1
Sequence:CCGGCCAAGTCTATCATTGACGAATCTCGAGATTCGTCAATGATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172703.2-5365s1c1
Sequence:CCGGCCTGGAACAAGGAAACAGCAACTCGAGTTGCTGTTTCCTTGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172703.2-1873s1c1
Sequence:CCGGCCTGAGAACTTGCCTTAGCAACTCGAGTTGCTAAGGCAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-3342s21c1
Sequence:CCGGCACGCATGGACCAGTACTTTACTCGAGTAAAGTACTGGTCCATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-1538s21c1
Sequence:CCGGCCTCATGATAGTCAGCTAATTCTCGAGAATTAGCTGACTATCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-2309s21c1
Sequence:CCGGGGGCTCACCTTCCCGTTTAAACTCGAGTTTAAACGGGAAGGTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172703.2-5342s21c1
Sequence:CCGGAGGTGATCATGGAGGATAAAGCTCGAGCTTTATCCTCCATGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172703.2-4981s21c1
Sequence:CCGGACTACAAGCATCCATAGTAAACTCGAGTTTACTATGGATGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks