EMAIL THIS PAGE TO A FRIEND

EIF4H

eukaryotic translation initiation factor 4H

128 Gene Product Result for
Synonyms: WBSCR1 WSCR1 eIF-4H
UniProtKB ID: Q15056, A8K3R1, D3DXF6, D3DXF8
Gene ID:
Human(7458) Summary: This gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(22384) eukaryotic translation initiation factor 4H
Rat(288599) eukaryotic translation initiation factor 4H
sheep(101110642) eukaryotic translation initiation factor 4H
naked mole-rat(101697933) eukaryotic translation initiation factor 4H
domestic guinea pig(100722722) eukaryotic translation initiation factor 4H
Zebrafish(402996) eukaryotic translation initiation factor 4h
dog(607749) eukaryotic translation initiation factor 4H
chicken(417490) eukaryotic translation initiation factor 4H
domestic cat(101098106) eukaryotic translation initiation factor 4H
cow(517409) eukaryotic translation initiation factor 4H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089401 MISSION® esiRNA esiRNA human WBSCR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022170 Rosetta Predictions human pricing
NM_031992 Rosetta Predictions human pricing
NM_001006957 Rosetta Predictions rat pricing
NM_033561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060960 predicted 173
2 SASI_Hs01_00060961 predicted 174
3 SASI_Hs01_00060962 predicted 246
4 SASI_Hs01_00060964 predicted 211
5 SASI_Hs02_00355604 predicted 297
6 SASI_Hs01_00060965 predicted 257
7 SASI_Hs02_00355605 predicted 333
8 SASI_Hs01_00060966 predicted 238
9 SASI_Hs01_00060967 predicted 252
10 SASI_Hs01_00060968 predicted 305
11 SASI_Hs01_00060963 predicted 145
12 SASI_Hs01_00060969 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080275 predicted 169
2 SASI_Hs01_00080276 predicted 172
3 SASI_Hs01_00080277 predicted 248
4 SASI_Hs01_00080278 predicted 1114
5 SASI_Hs01_00080280 predicted 205
6 SASI_Hs02_00359179 predicted 293
7 SASI_Hs01_00080281 predicted 251
8 SASI_Hs02_00359180 predicted 330
9 SASI_Hs01_00080282 predicted 231
10 SASI_Hs01_00080283 predicted 246
11 SASI_Hs01_00080279 predicted 144
12 SASI_Hs01_00080284 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198509 predicted 1193
2 SASI_Rn01_00054482 predicted 941
3 SASI_Rn01_00054483 predicted 884
4 SASI_Rn01_00054484 predicted 772
5 SASI_Rn01_00054485 predicted 1132
6 SASI_Rn01_00054486 predicted 763
7 SASI_Rn01_00054487 predicted 1038
8 SASI_Rn01_00054489 predicted 948
9 SASI_Rn02_00198510 predicted 277
10 SASI_Rn01_00054490 predicted 1068
11 SASI_Rn01_00054481 predicted 275
12 SASI_Rn01_00054488 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080905 predicted 1030
2 SASI_Mm01_00080906 predicted 1203
3 SASI_Mm01_00080907 predicted 1073
4 SASI_Mm01_00080908 predicted 757
5 SASI_Mm02_00337387 predicted 937
6 SASI_Mm01_00080909 predicted 866
7 SASI_Mm01_00080910 predicted 938
8 SASI_Mm01_00080911 predicted 1191
9 SASI_Mm01_00080912 predicted 1259
10 SASI_Mm01_00080913 predicted 936
11 SASI_Mm01_00080914 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022170
VALIDATED
EIF4H MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4H
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-198s21c1
Sequence:CCGGGATCTCAGCATAAGGAGTGTACTCGAGTACACTCCTTATGCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022170.1-454s21c1
Sequence:CCGGATTCCCGGGATGACTTCAATTCTCGAGAATTGAAGTCATCCCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-175s21c1
Sequence:CCGGGCGACATAGATGCTATCTTTACTCGAGTAAAGATAGCATCTATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-889s21c1
Sequence:CCGGGAGTGCATGTCAGCTGTTAACCTCGAGGTTAACAGCTGACATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-229s21c1
Sequence:CCGGGAGACAAAGACACAGATAAATCTCGAGATTTATCTGTGTCTTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022170.1-406s1c1
Sequence:CCGGCAGATGACAGAGGAATGGGTACTCGAGTACCCATTCCTCTGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-637s1c1
Sequence:CCGGGACTCCAGCTTAAACCTCGAACTCGAGTTCGAGGTTTAAGCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022170.1-686s1c1
Sequence:CCGGCAATCCCAACTCTGCTATCTTCTCGAGAAGATAGCAGAGTTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-198s1c1
Sequence:CCGGGATCTCAGCATAAGGAGTGTACTCGAGTACACTCCTTATGCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-2255s1c1
Sequence:CCGGGCTTCTGAGATAAGAACCATTCTCGAGAATGGTTCTTATCTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022170
VALIDATED
EIF4H MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4H
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-198s21c1
Sequence:CCGGGATCTCAGCATAAGGAGTGTACTCGAGTACACTCCTTATGCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022170.1-454s21c1
Sequence:CCGGATTCCCGGGATGACTTCAATTCTCGAGAATTGAAGTCATCCCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-175s21c1
Sequence:CCGGGCGACATAGATGCTATCTTTACTCGAGTAAAGATAGCATCTATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-889s21c1
Sequence:CCGGGAGTGCATGTCAGCTGTTAACCTCGAGGTTAACAGCTGACATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-229s21c1
Sequence:CCGGGAGACAAAGACACAGATAAATCTCGAGATTTATCTGTGTCTTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022170.1-406s1c1
Sequence:CCGGCAGATGACAGAGGAATGGGTACTCGAGTACCCATTCCTCTGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-637s1c1
Sequence:CCGGGACTCCAGCTTAAACCTCGAACTCGAGTTCGAGGTTTAAGCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022170.1-686s1c1
Sequence:CCGGCAATCCCAACTCTGCTATCTTCTCGAGAAGATAGCAGAGTTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-198s1c1
Sequence:CCGGGATCTCAGCATAAGGAGTGTACTCGAGTACACTCCTTATGCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-2255s1c1
Sequence:CCGGGCTTCTGAGATAAGAACCATTCTCGAGAATGGTTCTTATCTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022170
VALIDATED
EIF4H MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4H
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-198s21c1
Sequence:CCGGGATCTCAGCATAAGGAGTGTACTCGAGTACACTCCTTATGCTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022170.1-454s21c1
Sequence:CCGGATTCCCGGGATGACTTCAATTCTCGAGAATTGAAGTCATCCCGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-175s21c1
Sequence:CCGGGCGACATAGATGCTATCTTTACTCGAGTAAAGATAGCATCTATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-889s21c1
Sequence:CCGGGAGTGCATGTCAGCTGTTAACCTCGAGGTTAACAGCTGACATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_022170.1-229s21c1
Sequence:CCGGGAGACAAAGACACAGATAAATCTCGAGATTTATCTGTGTCTTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022170.1-406s1c1
Sequence:CCGGCAGATGACAGAGGAATGGGTACTCGAGTACCCATTCCTCTGTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-637s1c1
Sequence:CCGGGACTCCAGCTTAAACCTCGAACTCGAGTTCGAGGTTTAAGCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022170.1-686s1c1
Sequence:CCGGCAATCCCAACTCTGCTATCTTCTCGAGAAGATAGCAGAGTTGGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-198s1c1
Sequence:CCGGGATCTCAGCATAAGGAGTGTACTCGAGTACACTCCTTATGCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022170.1-2255s1c1
Sequence:CCGGGCTTCTGAGATAAGAACCATTCTCGAGAATGGTTCTTATCTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033561
VALIDATED
EIF4H MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 4H
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-276s1c1
Sequence:CCGGGGGTTCTGCTATGTAGAATTTCTCGAGAAATTCTACATAGCAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-152s1c1
Sequence:CCGGCTACACAGCTTACGTAGGAAACTCGAGTTTCCTACGTAAGCTGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-753s1c1
Sequence:CCGGGTGGTTCAGAAGGAGCAAGAACTCGAGTTCTTGCTCCTTCTGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-615s1c1
Sequence:CCGGGACTTCAGAGAACCCACAGAACTCGAGTTCTGTGGGTTCTCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-248s1c1
Sequence:CCGGCAGAGACAAAGACACAGACAACTCGAGTTGTCTGTGTCTTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-250s1c1
Sequence:CCGGGAGACAAAGACACAGACAAATCTCGAGATTTGTCTGTGTCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033561.1-208s1c1
Sequence:CCGGCTATCTTTAAGGATCTCAGCACTCGAGTGCTGAGATCCTTAAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-917s1c1
Sequence:CCGGGCTGTTAACAAGTGGTTTCTACTCGAGTAGAAACCACTTGTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-1082s1c1
Sequence:CCGGGCTTCATCCTTTGCTTTCTTTCTCGAGAAAGAAAGCAAAGGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033561
VALIDATED
EIF4H MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 4H
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-276s1c1
Sequence:CCGGGGGTTCTGCTATGTAGAATTTCTCGAGAAATTCTACATAGCAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-152s1c1
Sequence:CCGGCTACACAGCTTACGTAGGAAACTCGAGTTTCCTACGTAAGCTGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-753s1c1
Sequence:CCGGGTGGTTCAGAAGGAGCAAGAACTCGAGTTCTTGCTCCTTCTGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-615s1c1
Sequence:CCGGGACTTCAGAGAACCCACAGAACTCGAGTTCTGTGGGTTCTCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-248s1c1
Sequence:CCGGCAGAGACAAAGACACAGACAACTCGAGTTGTCTGTGTCTTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-250s1c1
Sequence:CCGGGAGACAAAGACACAGACAAATCTCGAGATTTGTCTGTGTCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033561.1-208s1c1
Sequence:CCGGCTATCTTTAAGGATCTCAGCACTCGAGTGCTGAGATCCTTAAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-917s1c1
Sequence:CCGGGCTGTTAACAAGTGGTTTCTACTCGAGTAGAAACCACTTGTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-1082s1c1
Sequence:CCGGGCTTCATCCTTTGCTTTCTTTCTCGAGAAAGAAAGCAAAGGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033561
VALIDATED
EIF4H MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 4H
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-276s1c1
Sequence:CCGGGGGTTCTGCTATGTAGAATTTCTCGAGAAATTCTACATAGCAGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-152s1c1
Sequence:CCGGCTACACAGCTTACGTAGGAAACTCGAGTTTCCTACGTAAGCTGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-753s1c1
Sequence:CCGGGTGGTTCAGAAGGAGCAAGAACTCGAGTTCTTGCTCCTTCTGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-615s1c1
Sequence:CCGGGACTTCAGAGAACCCACAGAACTCGAGTTCTGTGGGTTCTCTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033561.1-248s1c1
Sequence:CCGGCAGAGACAAAGACACAGACAACTCGAGTTGTCTGTGTCTTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-250s1c1
Sequence:CCGGGAGACAAAGACACAGACAAATCTCGAGATTTGTCTGTGTCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033561.1-208s1c1
Sequence:CCGGCTATCTTTAAGGATCTCAGCACTCGAGTGCTGAGATCCTTAAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-917s1c1
Sequence:CCGGGCTGTTAACAAGTGGTTTCTACTCGAGTAGAAACCACTTGTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_033561.1-1082s1c1
Sequence:CCGGGCTTCATCCTTTGCTTTCTTTCTCGAGAAAGAAAGCAAAGGATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks