EMAIL THIS PAGE TO A FRIEND

EIF5A2

eukaryotic translation initiation factor 5A2

246 Gene Product Result for
Synonyms: EIF-5A2 eIF5AII
UniProtKB ID: Q9GZV4, B2R4V5
Gene ID:
Mouse(208691) eukaryotic translation initiation factor 5A2
Rat(310261) eukaryotic translation initiation factor 5A2
Zebrafish(406546) eukaryotic translation initiation factor 5A2
cow(506307) eukaryotic translation initiation factor 5A2
domestic cat(101085997) eukaryotic translation initiation factor 5A2
dog(488164) eukaryotic translation initiation factor 5A2
chicken(396545) eukaryotic translation initiation factor 5A2
domestic guinea pig(100729510) eukaryotic translation initiation factor 5A2
naked mole-rat(101697895) eukaryotic translation initiation factor 5A2
sheep(101116949) eukaryotic translation initiation factor 5A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020390 Rosetta Predictions human pricing
XM_001063995 Rosetta Predictions rat pricing
XM_226974 Rosetta Predictions rat pricing
NM_177586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211442 predicted 426
2 SASI_Hs01_00211443 predicted 296
3 SASI_Hs01_00211445 predicted 241
4 SASI_Hs01_00211446 predicted 279
5 SASI_Hs01_00211447 predicted 352
6 SASI_Hs01_00211448 predicted 446
7 SASI_Hs01_00211449 predicted 441
8 SASI_Hs01_00211450 predicted 1011
9 SASI_Hs01_00211451 predicted 401
10 SASI_Hs02_00353364 predicted 514
11 SASI_Hs01_00211444 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308983 predicted 257
2 SASI_Rn02_00308984 predicted 223
3 SASI_Rn02_00308985 predicted 256
4 SASI_Rn02_00308986 predicted 209
5 SASI_Rn02_00308987 predicted 211
6 SASI_Rn02_00308988 predicted 233
7 SASI_Rn02_00308989 predicted 243
8 SASI_Rn02_00308990 predicted 308
9 SASI_Rn02_00308991 predicted 269
10 SASI_Rn02_00308992 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384001 predicted 1081
2 SASI_Rn02_00384002 predicted 736
3 SASI_Rn02_00384003 predicted 1405
4 SASI_Rn02_00384004 predicted 1373
5 SASI_Rn02_00384005 predicted 883
6 SASI_Rn02_00384006 predicted 1329
7 SASI_Rn02_00384007 predicted 1415
8 SASI_Rn02_00384008 predicted 1317
9 SASI_Rn02_00384009 predicted 1438
10 SASI_Rn02_00384010 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182310 predicted 635
2 SASI_Mm01_00182311 predicted 572
3 SASI_Mm01_00182312 predicted 632
4 SASI_Mm01_00182313 predicted 304
5 SASI_Mm01_00182314 predicted 291
6 SASI_Mm01_00182315 predicted 361
7 SASI_Mm01_00182316 predicted 669
8 SASI_Mm01_00182317 predicted 609
9 SASI_Mm01_00182318 predicted 395
10 SASI_Mm01_00182319 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020390
VALIDATED
EIF5A2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5A2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020390.5-2776s1c1
Sequence:CCGGGCTGGTGTTATGATTCAGTATCTCGAGATACTGAATCATAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020390.5-408s1c1
Sequence:CCGGGCATTCAAGATGGTTACCTTTCTCGAGAAAGGTAACCATCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020390.5-449s1c1
Sequence:CCGGGAAGTTCGTGAGGATCTTAAACTCGAGTTTAAGATCCTCACGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020390.5-359s1c1
Sequence:CCGGCACAACATGGATGTTCCAAATCTCGAGATTTGGAACATCCATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-449s21c1
Sequence:CCGGGAAGTTCGTGAGGATCTTAAACTCGAGTTTAAGATCCTCACGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020390.5-559s21c1
Sequence:CCGGAGAATATGCTGTAGCCATAAACTCGAGTTTATGGCTACAGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-951s21c1
Sequence:CCGGGGTATTGAAGTACCATATTTACTCGAGTAAATATGGTACTTCAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-300s21c1
Sequence:CCGGACCTTGTTGGAATTGATATTTCTCGAGAAATATCAATTCCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020390.5-408s21c1
Sequence:CCGGGCATTCAAGATGGTTACCTTTCTCGAGAAAGGTAACCATCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020390
VALIDATED
EIF5A2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5A2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020390.5-2776s1c1
Sequence:CCGGGCTGGTGTTATGATTCAGTATCTCGAGATACTGAATCATAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020390.5-408s1c1
Sequence:CCGGGCATTCAAGATGGTTACCTTTCTCGAGAAAGGTAACCATCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020390.5-449s1c1
Sequence:CCGGGAAGTTCGTGAGGATCTTAAACTCGAGTTTAAGATCCTCACGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020390.5-359s1c1
Sequence:CCGGCACAACATGGATGTTCCAAATCTCGAGATTTGGAACATCCATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-449s21c1
Sequence:CCGGGAAGTTCGTGAGGATCTTAAACTCGAGTTTAAGATCCTCACGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020390.5-559s21c1
Sequence:CCGGAGAATATGCTGTAGCCATAAACTCGAGTTTATGGCTACAGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-951s21c1
Sequence:CCGGGGTATTGAAGTACCATATTTACTCGAGTAAATATGGTACTTCAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-300s21c1
Sequence:CCGGACCTTGTTGGAATTGATATTTCTCGAGAAATATCAATTCCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020390.5-408s21c1
Sequence:CCGGGCATTCAAGATGGTTACCTTTCTCGAGAAAGGTAACCATCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020390
VALIDATED
EIF5A2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5A2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020390.5-2776s1c1
Sequence:CCGGGCTGGTGTTATGATTCAGTATCTCGAGATACTGAATCATAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020390.5-408s1c1
Sequence:CCGGGCATTCAAGATGGTTACCTTTCTCGAGAAAGGTAACCATCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020390.5-449s1c1
Sequence:CCGGGAAGTTCGTGAGGATCTTAAACTCGAGTTTAAGATCCTCACGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020390.5-359s1c1
Sequence:CCGGCACAACATGGATGTTCCAAATCTCGAGATTTGGAACATCCATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-449s21c1
Sequence:CCGGGAAGTTCGTGAGGATCTTAAACTCGAGTTTAAGATCCTCACGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020390.5-559s21c1
Sequence:CCGGAGAATATGCTGTAGCCATAAACTCGAGTTTATGGCTACAGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-951s21c1
Sequence:CCGGGGTATTGAAGTACCATATTTACTCGAGTAAATATGGTACTTCAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020390.5-300s21c1
Sequence:CCGGACCTTGTTGGAATTGATATTTCTCGAGAAATATCAATTCCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020390.5-408s21c1
Sequence:CCGGGCATTCAAGATGGTTACCTTTCTCGAGAAAGGTAACCATCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177586
EIF5A2 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5A2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-300s1c1
Sequence:CCGGCCAAGGTACACCTTGTTGGAACTCGAGTTCCAACAAGGTGTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-394s1c1
Sequence:CCGGGAGAAACGATTATCAACTCATCTCGAGATGAGTTGATAATCGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177586.4-3270s1c1
Sequence:CCGGGCCTCAAATGTTAGTTTGATACTCGAGTATCAAACTAACATTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-186s1c1
Sequence:CCGGGCACTTATCCTATGCAGTGCTCTCGAGAGCACTGCATAGGATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177586
EIF5A2 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5A2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-300s1c1
Sequence:CCGGCCAAGGTACACCTTGTTGGAACTCGAGTTCCAACAAGGTGTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-394s1c1
Sequence:CCGGGAGAAACGATTATCAACTCATCTCGAGATGAGTTGATAATCGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177586.4-3270s1c1
Sequence:CCGGGCCTCAAATGTTAGTTTGATACTCGAGTATCAAACTAACATTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-186s1c1
Sequence:CCGGGCACTTATCCTATGCAGTGCTCTCGAGAGCACTGCATAGGATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177586
EIF5A2 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5A2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-300s1c1
Sequence:CCGGCCAAGGTACACCTTGTTGGAACTCGAGTTCCAACAAGGTGTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-394s1c1
Sequence:CCGGGAGAAACGATTATCAACTCATCTCGAGATGAGTTGATAATCGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177586.4-3270s1c1
Sequence:CCGGGCCTCAAATGTTAGTTTGATACTCGAGTATCAAACTAACATTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177586.4-186s1c1
Sequence:CCGGGCACTTATCCTATGCAGTGCTCTCGAGAGCACTGCATAGGATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks