EMAIL THIS PAGE TO A FRIEND

EIF5A

eukaryotic translation initiation factor 5A

Synonyms: EIF-5A EIF5A1 eIF5AI
Gene ID:
Mouse(276770) eukaryotic translation initiation factor 5A
Rat(287444) eukaryotic translation initiation factor 5A
sheep(100307039) eukaryotic translation initiation factor 5A
naked mole-rat(101715287) eukaryotic translation initiation factor 5A
domestic guinea pig(100713079) eukaryotic translation initiation factor 5A
Zebrafish(406464) eukaryotic translation initiation factor 5A
cow(444990) eukaryotic translation initiation factor 5A
domestic cat(101095386) eukaryotic translation initiation factor 5A
dog(489468) eukaryotic translation initiation factor 5A
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147491 MISSION® esiRNA esiRNA human EIF5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001970 Rosetta Predictions human pricing
NM_001033681 Rosetta Predictions rat pricing
NM_181582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332931 predicted 610
2 SASI_Hs02_00332932 predicted 558
3 SASI_Hs02_00332933 predicted 303
4 SASI_Hs02_00332934 predicted 337
5 SASI_Hs02_00332935 predicted 413
6 SASI_Hs02_00332936 predicted 494
7 SASI_Hs02_00332937 predicted 291
8 SASI_Hs02_00332938 predicted 542
9 SASI_Hs02_00332939 predicted 494
10 SASI_Hs02_00332940 predicted 331
11 SASI_Hs01_00074983 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203691 predicted 220
2 SASI_Rn01_00079266 predicted 401
3 SASI_Rn02_00203692 predicted 761
4 SASI_Rn01_00079267 predicted 319
5 SASI_Rn01_00079268 predicted 656
6 SASI_Rn01_00079269 predicted 280
7 SASI_Rn02_00203693 predicted 822
8 SASI_Rn01_00079270 predicted 897
9 SASI_Rn01_00079271 predicted 921
10 SASI_Rn02_00203694 predicted 731
11 SASI_Rn01_00079272 predicted 390
12 SASI_Rn01_00079273 predicted 607
13 SASI_Rn01_00079274 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349837 predicted 454
2 SASI_Mm02_00349838 predicted 456
3 SASI_Mm02_00349839 predicted 686
4 SASI_Mm02_00349840 predicted 455
5 SASI_Mm02_00349841 predicted 629
6 SASI_Mm02_00349842 predicted 761
7 SASI_Mm02_00349843 predicted 750
8 SASI_Mm02_00349844 predicted 921
9 SASI_Mm02_00349845 predicted 829
10 SASI_Mm02_00349846 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001970
VALIDATED
EIF5A MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-307s21c1
Sequence:CCGGGCATTACGTAAGAATGGCTTTCTCGAGAAAGCCATTCTTACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-345s21c1
Sequence:CCGGGCCATGTAAGATCGTCGAGATCTCGAGATCTCGACGATCTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-431s21c1
Sequence:CCGGCTGGGAAGAAATATGAAGATACTCGAGTATCTTCATATTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-457s21c1
Sequence:CCGGCCGTCAACTCATAATATGGATCTCGAGATCCATATTATGAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001970.3-689s1c1
Sequence:CCGGCTCCTCCTACACAATTTATTTCTCGAGAAATAAATTGTGTAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001970.3-318s1c1
Sequence:CCGGCTGGGAAGAAATATGAAGATACTCGAGTATCTTCATATTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001970.3-194s1c1
Sequence:CCGGGCATTACGTAAGAATGGCTTTCTCGAGAAAGCCATTCTTACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001970.3-344s1c1
Sequence:CCGGCCGTCAACTCATAATATGGATCTCGAGATCCATATTATGAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001970.3-232s1c1
Sequence:CCGGGCCATGTAAGATCGTCGAGATCTCGAGATCTCGACGATCTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001970
VALIDATED
EIF5A MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-307s21c1
Sequence:CCGGGCATTACGTAAGAATGGCTTTCTCGAGAAAGCCATTCTTACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-345s21c1
Sequence:CCGGGCCATGTAAGATCGTCGAGATCTCGAGATCTCGACGATCTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-431s21c1
Sequence:CCGGCTGGGAAGAAATATGAAGATACTCGAGTATCTTCATATTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-457s21c1
Sequence:CCGGCCGTCAACTCATAATATGGATCTCGAGATCCATATTATGAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001970.3-689s1c1
Sequence:CCGGCTCCTCCTACACAATTTATTTCTCGAGAAATAAATTGTGTAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001970.3-318s1c1
Sequence:CCGGCTGGGAAGAAATATGAAGATACTCGAGTATCTTCATATTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001970.3-194s1c1
Sequence:CCGGGCATTACGTAAGAATGGCTTTCTCGAGAAAGCCATTCTTACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001970.3-344s1c1
Sequence:CCGGCCGTCAACTCATAATATGGATCTCGAGATCCATATTATGAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001970.3-232s1c1
Sequence:CCGGGCCATGTAAGATCGTCGAGATCTCGAGATCTCGACGATCTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001970
VALIDATED
EIF5A MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-307s21c1
Sequence:CCGGGCATTACGTAAGAATGGCTTTCTCGAGAAAGCCATTCTTACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-345s21c1
Sequence:CCGGGCCATGTAAGATCGTCGAGATCTCGAGATCTCGACGATCTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-431s21c1
Sequence:CCGGCTGGGAAGAAATATGAAGATACTCGAGTATCTTCATATTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001970.4-457s21c1
Sequence:CCGGCCGTCAACTCATAATATGGATCTCGAGATCCATATTATGAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001970.3-689s1c1
Sequence:CCGGCTCCTCCTACACAATTTATTTCTCGAGAAATAAATTGTGTAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001970.3-318s1c1
Sequence:CCGGCTGGGAAGAAATATGAAGATACTCGAGTATCTTCATATTTCTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001970.3-194s1c1
Sequence:CCGGGCATTACGTAAGAATGGCTTTCTCGAGAAAGCCATTCTTACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001970.3-344s1c1
Sequence:CCGGCCGTCAACTCATAATATGGATCTCGAGATCCATATTATGAGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001970.3-232s1c1
Sequence:CCGGGCCATGTAAGATCGTCGAGATCTCGAGATCTCGACGATCTTACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181582
EIF5A MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-319s21c1
Sequence:CCGGCGTCGAGATGTCTACTTCGAACTCGAGTTCGAAGTAGACATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181582.3-756s21c1
Sequence:CCGGGCTGGACTCCTATTCAAATTTCTCGAGAAATTTGAATAGGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-569s21c1
Sequence:CCGGGAGCAGAAGTATGACTGTGGACTCGAGTCCACAGTCATACTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-444s21c1
Sequence:CCGGCCAACATCAAACGGAATGACTCTCGAGAGTCATTCCGTTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-254s21c1
Sequence:CCGGCCAATGCAGTGCTCAGCATTACTCGAGTAATGCTGAGCACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-256s1c1
Sequence:CCGGCCAATGCAGTGCTCAGCATTACTCGAGTAATGCTGAGCACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-321s1c1
Sequence:CCGGCGTCGAGATGTCTACTTCGAACTCGAGTTCGAAGTAGACATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-446s1c1
Sequence:CCGGCCAACATCAAACGGAATGACTCTCGAGAGTCATTCCGTTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181582.2-758s1c1
Sequence:CCGGGCTGGACTCCTATTCAAATTTCTCGAGAAATTTGAATAGGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-571s1c1
Sequence:CCGGGAGCAGAAGTATGACTGTGGACTCGAGTCCACAGTCATACTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181582
EIF5A MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-319s21c1
Sequence:CCGGCGTCGAGATGTCTACTTCGAACTCGAGTTCGAAGTAGACATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181582.3-756s21c1
Sequence:CCGGGCTGGACTCCTATTCAAATTTCTCGAGAAATTTGAATAGGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-569s21c1
Sequence:CCGGGAGCAGAAGTATGACTGTGGACTCGAGTCCACAGTCATACTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-444s21c1
Sequence:CCGGCCAACATCAAACGGAATGACTCTCGAGAGTCATTCCGTTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-254s21c1
Sequence:CCGGCCAATGCAGTGCTCAGCATTACTCGAGTAATGCTGAGCACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-256s1c1
Sequence:CCGGCCAATGCAGTGCTCAGCATTACTCGAGTAATGCTGAGCACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-321s1c1
Sequence:CCGGCGTCGAGATGTCTACTTCGAACTCGAGTTCGAAGTAGACATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-446s1c1
Sequence:CCGGCCAACATCAAACGGAATGACTCTCGAGAGTCATTCCGTTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181582.2-758s1c1
Sequence:CCGGGCTGGACTCCTATTCAAATTTCTCGAGAAATTTGAATAGGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-571s1c1
Sequence:CCGGGAGCAGAAGTATGACTGTGGACTCGAGTCCACAGTCATACTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181582
EIF5A MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-319s21c1
Sequence:CCGGCGTCGAGATGTCTACTTCGAACTCGAGTTCGAAGTAGACATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181582.3-756s21c1
Sequence:CCGGGCTGGACTCCTATTCAAATTTCTCGAGAAATTTGAATAGGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-569s21c1
Sequence:CCGGGAGCAGAAGTATGACTGTGGACTCGAGTCCACAGTCATACTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-444s21c1
Sequence:CCGGCCAACATCAAACGGAATGACTCTCGAGAGTCATTCCGTTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181582.3-254s21c1
Sequence:CCGGCCAATGCAGTGCTCAGCATTACTCGAGTAATGCTGAGCACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-256s1c1
Sequence:CCGGCCAATGCAGTGCTCAGCATTACTCGAGTAATGCTGAGCACTGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-321s1c1
Sequence:CCGGCGTCGAGATGTCTACTTCGAACTCGAGTTCGAAGTAGACATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-446s1c1
Sequence:CCGGCCAACATCAAACGGAATGACTCTCGAGAGTCATTCCGTTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181582.2-758s1c1
Sequence:CCGGGCTGGACTCCTATTCAAATTTCTCGAGAAATTTGAATAGGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181582.2-571s1c1
Sequence:CCGGGAGCAGAAGTATGACTGTGGACTCGAGTCCACAGTCATACTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks