EMAIL THIS PAGE TO A FRIEND

EIF5AL1

eukaryotic translation initiation factor 5A-like 1

23 Gene Product Result for
Synonyms: EIF5AP1 bA342M3.3
Species: Human EIF5AL1(143244)
UniProtKB ID: Q6IS14
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301046 ANTI-EIF5AL1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099692 Rosetta Predictions human pricing
XM_928947 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321125 predicted 483
2 SASI_Hs02_00321126 predicted 343
3 SASI_Hs02_00321127 predicted 254
4 SASI_Hs02_00321128 predicted 266
5 SASI_Hs02_00321129 predicted 303
6 SASI_Hs02_00321130 predicted 607
7 SASI_Hs02_00321131 predicted 542
8 SASI_Hs02_00321132 predicted 606
9 SASI_Hs02_00321133 predicted 418
10 SASI_Hs02_00321134 predicted 171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298851 predicted 696
2 SASI_Hs01_00298852 predicted 456
3 SASI_Hs01_00298853 predicted 377
4 SASI_Hs01_00298854 predicted 469
5 SASI_Hs01_00298855 predicted 509
6 SASI_Hs01_00298856 predicted 527
7 SASI_Hs01_00298857 predicted 551
8 SASI_Hs01_00298858 predicted 419
9 SASI_Hs01_00298859 predicted 428
10 SASI_Hs01_00298860 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099692
EIF5AL1 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5A-like 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3157s21c1
Sequence:CCGGTGTTCTCTTCTTGGCTAATATCTCGAGATATTAGCCAAGAAGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3385s21c1
Sequence:CCGGCCTACAGCTACCGCTAGATTTCTCGAGAAATCTAGCGGTAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3192s21c1
Sequence:CCGGGTTGCAGATGTACGTCATATACTCGAGTATATGACGTACATCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3339s21c1
Sequence:CCGGAGAAGCAATGGGTGATCTAAACTCGAGTTTAGATCACCCATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099692
EIF5AL1 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5A-like 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3157s21c1
Sequence:CCGGTGTTCTCTTCTTGGCTAATATCTCGAGATATTAGCCAAGAAGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3385s21c1
Sequence:CCGGCCTACAGCTACCGCTAGATTTCTCGAGAAATCTAGCGGTAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3192s21c1
Sequence:CCGGGTTGCAGATGTACGTCATATACTCGAGTATATGACGTACATCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3339s21c1
Sequence:CCGGAGAAGCAATGGGTGATCTAAACTCGAGTTTAGATCACCCATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099692
EIF5AL1 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5A-like 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3157s21c1
Sequence:CCGGTGTTCTCTTCTTGGCTAATATCTCGAGATATTAGCCAAGAAGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3385s21c1
Sequence:CCGGCCTACAGCTACCGCTAGATTTCTCGAGAAATCTAGCGGTAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3192s21c1
Sequence:CCGGGTTGCAGATGTACGTCATATACTCGAGTATATGACGTACATCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099692.1-3339s21c1
Sequence:CCGGAGAAGCAATGGGTGATCTAAACTCGAGTTTAGATCACCCATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks