EMAIL THIS PAGE TO A FRIEND

EIF5B

eukaryotic translation initiation factor 5B

87 Gene Product Result for
Synonyms: IF2
UniProtKB ID: O60841, O95805, Q53RV7, Q53SI8, Q9UF81, Q9UMN7
Gene ID:
Human(9669) Summary: Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Mouse(226982) eukaryotic translation initiation factor 5B
Rat(308306) eukaryotic translation initiation factor 5B
Zebrafish(561194) eukaryotic translation initiation factor 5B
domestic cat(101095815) eukaryotic translation initiation factor 5B
cow(532850) eukaryotic translation initiation factor 5B
Horse(100050422) eukaryotic translation initiation factor 5B
dog(474556) eukaryotic translation initiation factor 5B
fruit fly(44261) CG10840 gene product from transcript CG10840-RE
chicken(395514) eukaryotic translation initiation factor 5B
sheep(101106067) eukaryotic translation initiation factor 5B
naked mole-rat(101699308) eukaryotic translation initiation factor 5B
domestic guinea pig(100719329) eukaryotic translation initiation factor 5B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015904 Rosetta Predictions human pricing
NM_001110141 Rosetta Predictions rat pricing
NM_198303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222323 predicted 2558
2 SASI_Hs01_00222324 predicted 3229
3 SASI_Hs02_00348496 predicted 3575
4 SASI_Hs01_00222326 predicted 2678
5 SASI_Hs01_00222327 predicted 3749
6 SASI_Hs01_00222328 predicted 2404
7 SASI_Hs01_00222329 predicted 2869
8 SASI_Hs01_00222330 predicted 3938
9 SASI_Hs01_00222331 predicted 2786
10 SASI_Hs02_00348497 predicted 2834
11 SASI_Hs01_00222325 predicted 2191
12 SASI_Hs01_00222332 predicted 2489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251042 predicted 3142
2 SASI_Rn02_00251043 predicted 2140
3 SASI_Rn02_00251044 predicted 2997
4 SASI_Rn02_00251045 predicted 2341
5 SASI_Rn02_00251046 predicted 2245
6 SASI_Rn02_00251047 predicted 3535
7 SASI_Rn02_00251048 predicted 3184
8 SASI_Rn02_00251049 predicted 3504
9 SASI_Rn02_00251050 predicted 2742
10 SASI_Rn02_00251051 predicted 3087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046426 predicted 3410
2 SASI_Mm01_00046427 predicted 3945
3 SASI_Mm01_00046428 predicted 2724
4 SASI_Mm01_00046429 predicted 2783
5 SASI_Mm01_00046430 predicted 2259
6 SASI_Mm02_00350934 predicted 3271
7 SASI_Mm01_00046433 predicted 3205
8 SASI_Mm01_00046434 predicted 2465
9 SASI_Mm01_00046435 predicted 3502
10 SASI_Mm02_00350935 predicted 3667
11 SASI_Mm01_00046431 predicted 2279
12 SASI_Mm01_00046432 predicted 3055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015904
VALIDATED
EIF5B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-4153s21c1
Sequence:CCGGGATCTAAAGCTCTTTCGATTTCTCGAGAAATCGAAAGAGCTTTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-2433s21c1
Sequence:CCGGCCTTCATTGTTGCACTCAATACTCGAGTATTGAGTGCAACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-1199s21c1
Sequence:CCGGGCCACTGTTAAAGCTATGCAACTCGAGTTGCATAGCTTTAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-2030s21c1
Sequence:CCGGCGGCGACTTGAACATAGTAAACTCGAGTTTACTATGTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-2541s1c1
Sequence:CCGGGCAGGGTTTGAATGCTGCTTTCTCGAGAAAGCAGCATTCAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-769s1c1
Sequence:CCGGCCTAACATAGAAAGTGGGAATCTCGAGATTCCCACTTTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-2390s1c1
Sequence:CCGGCCTTCATTGTTGCACTCAATACTCGAGTATTGAGTGCAACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-1987s1c1
Sequence:CCGGCGGCGACTTGAACATAGTAAACTCGAGTTTACTATGTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-1156s1c1
Sequence:CCGGGCCACTGTTAAAGCTATGCAACTCGAGTTGCATAGCTTTAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015904
VALIDATED
EIF5B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-4153s21c1
Sequence:CCGGGATCTAAAGCTCTTTCGATTTCTCGAGAAATCGAAAGAGCTTTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-2433s21c1
Sequence:CCGGCCTTCATTGTTGCACTCAATACTCGAGTATTGAGTGCAACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-1199s21c1
Sequence:CCGGGCCACTGTTAAAGCTATGCAACTCGAGTTGCATAGCTTTAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-2030s21c1
Sequence:CCGGCGGCGACTTGAACATAGTAAACTCGAGTTTACTATGTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-2541s1c1
Sequence:CCGGGCAGGGTTTGAATGCTGCTTTCTCGAGAAAGCAGCATTCAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-769s1c1
Sequence:CCGGCCTAACATAGAAAGTGGGAATCTCGAGATTCCCACTTTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-2390s1c1
Sequence:CCGGCCTTCATTGTTGCACTCAATACTCGAGTATTGAGTGCAACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-1987s1c1
Sequence:CCGGCGGCGACTTGAACATAGTAAACTCGAGTTTACTATGTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-1156s1c1
Sequence:CCGGGCCACTGTTAAAGCTATGCAACTCGAGTTGCATAGCTTTAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015904
VALIDATED
EIF5B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-4153s21c1
Sequence:CCGGGATCTAAAGCTCTTTCGATTTCTCGAGAAATCGAAAGAGCTTTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-2433s21c1
Sequence:CCGGCCTTCATTGTTGCACTCAATACTCGAGTATTGAGTGCAACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-1199s21c1
Sequence:CCGGGCCACTGTTAAAGCTATGCAACTCGAGTTGCATAGCTTTAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015904.3-2030s21c1
Sequence:CCGGCGGCGACTTGAACATAGTAAACTCGAGTTTACTATGTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-2541s1c1
Sequence:CCGGGCAGGGTTTGAATGCTGCTTTCTCGAGAAAGCAGCATTCAAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-769s1c1
Sequence:CCGGCCTAACATAGAAAGTGGGAATCTCGAGATTCCCACTTTCTATGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-2390s1c1
Sequence:CCGGCCTTCATTGTTGCACTCAATACTCGAGTATTGAGTGCAACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-1987s1c1
Sequence:CCGGCGGCGACTTGAACATAGTAAACTCGAGTTTACTATGTTCAAGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015904.2-1156s1c1
Sequence:CCGGGCCACTGTTAAAGCTATGCAACTCGAGTTGCATAGCTTTAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198303
VALIDATED
EIF5B MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 5B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.2-2633s1c1
Sequence:CCGGGAGCGTGCAAAGGCCATTATTCTCGAGAATAATGGCCTTTGCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-955s1c1
Sequence:CCGGGAAGAGTGACTGGCAGCTTATCTCGAGATAAGCTGCCAGTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-227s1c1
Sequence:CCGGGATGAATTGATCCATGAGTTACTCGAGTAACTCATGGATCAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198303.1-452s1c1
Sequence:CCGGGCCTTTGATGTAAGAATTGAACTCGAGTTCAATTCTTACATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198303.1-250s1c1
Sequence:CCGGGCAGACACTAAATGCTATCAACTCGAGTTGATAGCATTTAGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198303.1-977s1c1
Sequence:CCGGGTGGAGCTGAAGAAAGTATTTCTCGAGAAATACTTTCTTCAGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198303.1-1085s1c1
Sequence:CCGGGCTGATGGACTTAGGTGTATACTCGAGTATACACCTAAGTCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198303.1-1115s1c1
Sequence:CCGGCCATGAGAAACCAAGCAACTTCTCGAGAAGTTGCTTGGTTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-498s1c1
Sequence:CCGGGTTTGGGAGTTAGAATCTTTACTCGAGTAAAGATTCTAACTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198303
VALIDATED
EIF5B MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 5B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.2-2633s1c1
Sequence:CCGGGAGCGTGCAAAGGCCATTATTCTCGAGAATAATGGCCTTTGCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-955s1c1
Sequence:CCGGGAAGAGTGACTGGCAGCTTATCTCGAGATAAGCTGCCAGTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-227s1c1
Sequence:CCGGGATGAATTGATCCATGAGTTACTCGAGTAACTCATGGATCAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198303.1-452s1c1
Sequence:CCGGGCCTTTGATGTAAGAATTGAACTCGAGTTCAATTCTTACATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198303.1-250s1c1
Sequence:CCGGGCAGACACTAAATGCTATCAACTCGAGTTGATAGCATTTAGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198303.1-977s1c1
Sequence:CCGGGTGGAGCTGAAGAAAGTATTTCTCGAGAAATACTTTCTTCAGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198303.1-1085s1c1
Sequence:CCGGGCTGATGGACTTAGGTGTATACTCGAGTATACACCTAAGTCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198303.1-1115s1c1
Sequence:CCGGCCATGAGAAACCAAGCAACTTCTCGAGAAGTTGCTTGGTTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-498s1c1
Sequence:CCGGGTTTGGGAGTTAGAATCTTTACTCGAGTAAAGATTCTAACTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198303
VALIDATED
EIF5B MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 5B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.2-2633s1c1
Sequence:CCGGGAGCGTGCAAAGGCCATTATTCTCGAGAATAATGGCCTTTGCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-955s1c1
Sequence:CCGGGAAGAGTGACTGGCAGCTTATCTCGAGATAAGCTGCCAGTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-227s1c1
Sequence:CCGGGATGAATTGATCCATGAGTTACTCGAGTAACTCATGGATCAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198303.1-452s1c1
Sequence:CCGGGCCTTTGATGTAAGAATTGAACTCGAGTTCAATTCTTACATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198303.1-250s1c1
Sequence:CCGGGCAGACACTAAATGCTATCAACTCGAGTTGATAGCATTTAGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198303.1-977s1c1
Sequence:CCGGGTGGAGCTGAAGAAAGTATTTCTCGAGAAATACTTTCTTCAGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198303.1-1085s1c1
Sequence:CCGGGCTGATGGACTTAGGTGTATACTCGAGTATACACCTAAGTCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198303.1-1115s1c1
Sequence:CCGGCCATGAGAAACCAAGCAACTTCTCGAGAAGTTGCTTGGTTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_198303.1-498s1c1
Sequence:CCGGGTTTGGGAGTTAGAATCTTTACTCGAGTAAAGATTCTAACTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks