EMAIL THIS PAGE TO A FRIEND

EIF6

eukaryotic translation initiation factor 6

114 Gene Product Result for
Synonyms: CAB EIF3A ITGB4BP b(2)gcn eIF-6 p27(BBP) p27BBP
UniProtKB ID: P56537, B7ZBG9, Q6IBN8, Q96TD5
Gene ID:
Human(3692) Summary: Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(16418) eukaryotic translation initiation factor 6
Rat(305506) eukaryotic translation initiation factor 6
sheep(100302338) eukaryotic translation initiation factor 6
Domestic Rabbit(100356830) eukaryotic translation initiation factor 6
Domestic Rabbit(100328704) eukaryotic translation initiation factor 6
Zebrafish(386850) eukaryotic translation initiation factor 6
cow(286811) eukaryotic translation initiation factor 6
domestic cat(101082644) eukaryotic translation initiation factor 6
dog(477210) eukaryotic translation initiation factor 6
chicken(419140) eukaryotic translation initiation factor 6
fruit fly(37776) CG17611 gene product from transcript CG17611-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002212 Rosetta Predictions human pricing
NM_181466 Rosetta Predictions human pricing
NM_181467 Rosetta Predictions human pricing
NM_181468 Rosetta Predictions human pricing
NM_181469 Rosetta Predictions human pricing
NM_001037352 Rosetta Predictions rat pricing
NM_010579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015747 predicted 772
2 SASI_Hs01_00015748 predicted 860
3 SASI_Hs01_00015749 predicted 796
4 SASI_Hs01_00015750 predicted 716
5 SASI_Hs01_00015751 predicted 744
6 SASI_Hs01_00015752 predicted 773
7 SASI_Hs01_00015753 predicted 800
8 SASI_Hs01_00015754 predicted 660
9 SASI_Hs01_00015755 predicted 810
10 SASI_Hs01_00015756 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179805 predicted 706
2 SASI_Hs01_00179806 predicted 805
3 SASI_Hs01_00179807 predicted 743
4 SASI_Hs01_00179808 predicted 659
5 SASI_Hs01_00179809 predicted 689
6 SASI_Hs01_00179810 predicted 723
7 SASI_Hs01_00179811 predicted 742
8 SASI_Hs01_00179812 predicted 603
9 SASI_Hs01_00179813 predicted 750
10 SASI_Hs01_00179814 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237429 predicted 599
2 SASI_Hs01_00237430 predicted 693
3 SASI_Hs01_00237431 predicted 625
4 SASI_Hs01_00237432 predicted 544
5 SASI_Hs01_00237433 predicted 579
6 SASI_Hs01_00237434 predicted 600
7 SASI_Hs01_00237435 predicted 631
8 SASI_Hs01_00237436 predicted 492
9 SASI_Hs01_00237437 predicted 643
10 SASI_Hs01_00237438 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111814 predicted 910
2 SASI_Hs01_00111815 predicted 1003
3 SASI_Hs01_00111816 predicted 944
4 SASI_Hs01_00111817 predicted 862
5 SASI_Hs01_00111818 predicted 892
6 SASI_Hs01_00111819 predicted 920
7 SASI_Hs01_00111820 predicted 952
8 SASI_Hs01_00111821 predicted 801
9 SASI_Hs01_00111822 predicted 954
10 SASI_Hs01_00111823 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123089 predicted 747
2 SASI_Hs01_00123090 predicted 839
3 SASI_Hs01_00123091 predicted 779
4 SASI_Hs01_00123092 predicted 684
5 SASI_Hs01_00123093 predicted 718
6 SASI_Hs01_00123094 predicted 749
7 SASI_Hs01_00123095 predicted 782
8 SASI_Hs01_00123096 predicted 630
9 SASI_Hs01_00123097 predicted 787
10 SASI_Hs01_00123098 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092710 predicted 230
2 SASI_Rn02_00204396 predicted 863
3 SASI_Rn01_00092711 predicted 534
4 SASI_Rn01_00092705 predicted 468
5 SASI_Rn01_00092706 predicted 876
6 SASI_Rn01_00092712 predicted 652
7 SASI_Rn01_00092713 predicted 987
8 SASI_Rn01_00092707 predicted 307
9 SASI_Rn02_00204397 predicted 670
10 SASI_Rn01_00092714 predicted 815
11 SASI_Rn01_00092708 predicted 883
12 SASI_Rn01_00092709 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034707 predicted 1256
2 SASI_Mm01_00034708 predicted 498
3 SASI_Mm01_00034709 predicted 807
4 SASI_Mm02_00318861 predicted 579
5 SASI_Mm01_00034710 predicted 921
6 SASI_Mm01_00034711 predicted 1088
7 SASI_Mm01_00034714 predicted 1162
8 SASI_Mm01_00034713 predicted 993
9 SASI_Mm01_00034715 predicted 1038
10 SASI_Mm01_00034716 predicted 553
11 SASI_Mm01_00034712 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002212
VALIDATED
EIF6 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-444s1c1
Sequence:CCGGACAGAAGAAATTCTGGCAGATCTCGAGATCTGCCAGAATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002212.2-277s1c1
Sequence:CCGGGTCTCCTGGTACCCAACAATACTCGAGTATTGTTGGGTACCAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-552s1c1
Sequence:CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-164s1c1
Sequence:CCGGAGAGAACTTCTACAGTGTGTTCTCGAGAACACACTGTAGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002212.2-861s21c1
Sequence:CCGGTTCTCCACATTCCGCCCAATCCTCGAGGATTGGGCGGAATGTGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-334s21c1
Sequence:CCGGTCCCAGACACAGTGCAGATTACTCGAGTAATCTGCACTGTGTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-807s21c1
Sequence:CCGGTGAGTCACCTTCCAAGTTGTTCTCGAGAACAACTTGGAAGGTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-552s21c1
Sequence:CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-726s21c1
Sequence:CCGGGAGAGTGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002212
VALIDATED
EIF6 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-444s1c1
Sequence:CCGGACAGAAGAAATTCTGGCAGATCTCGAGATCTGCCAGAATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002212.2-277s1c1
Sequence:CCGGGTCTCCTGGTACCCAACAATACTCGAGTATTGTTGGGTACCAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-552s1c1
Sequence:CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-164s1c1
Sequence:CCGGAGAGAACTTCTACAGTGTGTTCTCGAGAACACACTGTAGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002212.2-861s21c1
Sequence:CCGGTTCTCCACATTCCGCCCAATCCTCGAGGATTGGGCGGAATGTGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-334s21c1
Sequence:CCGGTCCCAGACACAGTGCAGATTACTCGAGTAATCTGCACTGTGTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-807s21c1
Sequence:CCGGTGAGTCACCTTCCAAGTTGTTCTCGAGAACAACTTGGAAGGTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-552s21c1
Sequence:CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-726s21c1
Sequence:CCGGGAGAGTGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002212
VALIDATED
EIF6 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-444s1c1
Sequence:CCGGACAGAAGAAATTCTGGCAGATCTCGAGATCTGCCAGAATTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002212.2-277s1c1
Sequence:CCGGGTCTCCTGGTACCCAACAATACTCGAGTATTGTTGGGTACCAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-552s1c1
Sequence:CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002212.2-164s1c1
Sequence:CCGGAGAGAACTTCTACAGTGTGTTCTCGAGAACACACTGTAGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002212.2-861s21c1
Sequence:CCGGTTCTCCACATTCCGCCCAATCCTCGAGGATTGGGCGGAATGTGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-334s21c1
Sequence:CCGGTCCCAGACACAGTGCAGATTACTCGAGTAATCTGCACTGTGTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-807s21c1
Sequence:CCGGTGAGTCACCTTCCAAGTTGTTCTCGAGAACAACTTGGAAGGTGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-552s21c1
Sequence:CCGGGTGCATCCCAAGACTTCAATTCTCGAGAATTGAAGTCTTGGGATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002212.2-726s21c1
Sequence:CCGGGAGAGTGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010579
VALIDATED
EIF6 MISSION shRNA Bacterial Glycerol Stock
eukaryotic translation initiation factor 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-1147s1c1
Sequence:CCGGGAGAGCGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-810s1c1
Sequence:CCGGTGTCACCACCTGCAATGACTACTCGAGTAGTCATTGCAGGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-540s1c1
Sequence:CCGGTGCCAAACTCACAAACGCCTACTCGAGTAGGCGTTTGTGAGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-933s1c1
Sequence:CCGGAGTAGGAAGCTACTGTGTCTTCTCGAGAAGACACAGTAGCTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010579.2-1147s21c1
Sequence:CCGGGAGAGCGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010579.2-810s21c1
Sequence:CCGGTGTCACCACCTGCAATGACTACTCGAGTAGTCATTGCAGGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010579.2-540s21c1
Sequence:CCGGTGCCAAACTCACAAACGCCTACTCGAGTAGGCGTTTGTGAGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010579.2-933s21c1
Sequence:CCGGAGTAGGAAGCTACTGTGTCTTCTCGAGAAGACACAGTAGCTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010579
VALIDATED
EIF6 MISSION shRNA shRNA Plasmid DNA
eukaryotic translation initiation factor 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-1147s1c1
Sequence:CCGGGAGAGCGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-810s1c1
Sequence:CCGGTGTCACCACCTGCAATGACTACTCGAGTAGTCATTGCAGGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-540s1c1
Sequence:CCGGTGCCAAACTCACAAACGCCTACTCGAGTAGGCGTTTGTGAGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-933s1c1
Sequence:CCGGAGTAGGAAGCTACTGTGTCTTCTCGAGAAGACACAGTAGCTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010579.2-1147s21c1
Sequence:CCGGGAGAGCGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010579.2-810s21c1
Sequence:CCGGTGTCACCACCTGCAATGACTACTCGAGTAGTCATTGCAGGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010579.2-540s21c1
Sequence:CCGGTGCCAAACTCACAAACGCCTACTCGAGTAGGCGTTTGTGAGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010579.2-933s21c1
Sequence:CCGGAGTAGGAAGCTACTGTGTCTTCTCGAGAAGACACAGTAGCTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010579
VALIDATED
EIF6 MISSION shRNA Lentiviral Transduction Particles
eukaryotic translation initiation factor 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-1147s1c1
Sequence:CCGGGAGAGCGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-810s1c1
Sequence:CCGGTGTCACCACCTGCAATGACTACTCGAGTAGTCATTGCAGGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-540s1c1
Sequence:CCGGTGCCAAACTCACAAACGCCTACTCGAGTAGGCGTTTGTGAGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010579.1-933s1c1
Sequence:CCGGAGTAGGAAGCTACTGTGTCTTCTCGAGAAGACACAGTAGCTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010579.2-1147s21c1
Sequence:CCGGGAGAGCGTCTTCAAGCTGAATCTCGAGATTCAGCTTGAAGACGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010579.2-810s21c1
Sequence:CCGGTGTCACCACCTGCAATGACTACTCGAGTAGTCATTGCAGGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010579.2-540s21c1
Sequence:CCGGTGCCAAACTCACAAACGCCTACTCGAGTAGGCGTTTGTGAGTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010579.2-933s21c1
Sequence:CCGGAGTAGGAAGCTACTGTGTCTTCTCGAGAAGACACAGTAGCTTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks