EMAIL THIS PAGE TO A FRIEND

ELAC1

elaC ribonuclease Z 1

119 Gene Product Result for
Synonyms: D29
UniProtKB ID: Q9H777, Q9NS99
Gene ID:
Mouse(114615) elaC homolog 1 (E. coli)
Rat(307604) elaC ribonuclease Z 1
Zebrafish(445109) elaC homolog 1 (E. coli)
dog(476197) elaC homolog 1 (E. coli)
domestic cat(101093400) elaC homolog 1 (E. coli)
cow(532568) elaC homolog 1 (E. coli)
Horse(100069650) elaC homolog 1 (E. coli)
sheep(101118238) elaC homolog 1 (E. coli)
domestic guinea pig(100719989) elaC ribonuclease Z 1
naked mole-rat(101703402) elaC ribonuclease Z 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018696 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018696 Rosetta Predictions human pricing
NM_001107406 Rosetta Predictions rat pricing
NM_053255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056973 predicted 244
2 SASI_Hs01_00056974 predicted 397
3 SASI_Hs02_00352221 predicted 358
4 SASI_Hs02_00352222 predicted 507
5 SASI_Hs01_00056976 predicted 1031
6 SASI_Hs01_00056977 predicted 262
7 SASI_Hs01_00056978 predicted 1000
8 SASI_Hs01_00056979 predicted 562
9 SASI_Hs01_00056980 predicted 629
10 SASI_Hs01_00056981 predicted 252
11 SASI_Hs01_00056975 predicted 264
12 SASI_Hs01_00056982 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228505 predicted 539
2 SASI_Rn02_00228506 predicted 564
3 SASI_Rn02_00228507 predicted 483
4 SASI_Rn02_00228508 predicted 404
5 SASI_Rn02_00228509 predicted 582
6 SASI_Rn02_00228510 predicted 467
7 SASI_Rn02_00228511 predicted 244
8 SASI_Rn02_00228512 predicted 239
9 SASI_Rn02_00228513 predicted 500
10 SASI_Rn02_00228514 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337877 predicted 1632
2 SASI_Mm02_00337878 predicted 1641
3 SASI_Mm02_00337879 predicted 231
4 SASI_Mm02_00337880 predicted 664
5 SASI_Mm01_00078897 predicted 241
6 SASI_Mm02_00337881 predicted 572
7 SASI_Mm01_00078898 predicted 508
8 SASI_Mm01_00078901 predicted 248
9 SASI_Mm01_00078902 predicted 238
10 SASI_Mm02_00337882 predicted 608
11 SASI_Mm01_00078895 predicted 515
12 SASI_Mm01_00078896 predicted 467
13 SASI_Mm01_00078899 predicted 981
14 SASI_Mm01_00078900 predicted 206
15 SASI_Mm01_00078903 predicted 933
16 SASI_Mm01_00078904 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053255
ELAC1 MISSION shRNA Bacterial Glycerol Stock
elaC ribonuclease Z 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-762s21c1
Sequence:CCGGTTGGATAATGGAGTTACAATTCTCGAGAATTGTAACTCCATTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-1021s21c1
Sequence:CCGGACTTCAGTCAGAGGTACAAACCTCGAGGTTTGTACCTCTGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-1153s21c1
Sequence:CCGGTCGGCATTCCGATCAAGAAATCTCGAGATTTCTTGATCGGAATGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053255.3-1900s21c1
Sequence:CCGGTGCGTTAGTCCTGCGTAATAACTCGAGTTATTACGCAGGACTAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-919s21c1
Sequence:CCGGATGATTCCCAGATGGACAAAGCTCGAGCTTTGTCCATCTGGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053255.2-1570s1c1
Sequence:CCGGGAGCAGAATTTGCATAGAGTTCTCGAGAACTCTATGCAAATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053255.2-1697s1c1
Sequence:CCGGCTTAGCACTTTGTTCAACATTCTCGAGAATGTTGAACAAAGTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053255
ELAC1 MISSION shRNA shRNA Plasmid DNA
elaC ribonuclease Z 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-762s21c1
Sequence:CCGGTTGGATAATGGAGTTACAATTCTCGAGAATTGTAACTCCATTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-1021s21c1
Sequence:CCGGACTTCAGTCAGAGGTACAAACCTCGAGGTTTGTACCTCTGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-1153s21c1
Sequence:CCGGTCGGCATTCCGATCAAGAAATCTCGAGATTTCTTGATCGGAATGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053255.3-1900s21c1
Sequence:CCGGTGCGTTAGTCCTGCGTAATAACTCGAGTTATTACGCAGGACTAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-919s21c1
Sequence:CCGGATGATTCCCAGATGGACAAAGCTCGAGCTTTGTCCATCTGGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053255.2-1570s1c1
Sequence:CCGGGAGCAGAATTTGCATAGAGTTCTCGAGAACTCTATGCAAATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053255.2-1697s1c1
Sequence:CCGGCTTAGCACTTTGTTCAACATTCTCGAGAATGTTGAACAAAGTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053255
ELAC1 MISSION shRNA Lentiviral Transduction Particles
elaC ribonuclease Z 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-762s21c1
Sequence:CCGGTTGGATAATGGAGTTACAATTCTCGAGAATTGTAACTCCATTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-1021s21c1
Sequence:CCGGACTTCAGTCAGAGGTACAAACCTCGAGGTTTGTACCTCTGACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-1153s21c1
Sequence:CCGGTCGGCATTCCGATCAAGAAATCTCGAGATTTCTTGATCGGAATGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053255.3-1900s21c1
Sequence:CCGGTGCGTTAGTCCTGCGTAATAACTCGAGTTATTACGCAGGACTAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053255.3-919s21c1
Sequence:CCGGATGATTCCCAGATGGACAAAGCTCGAGCTTTGTCCATCTGGGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053255.2-1570s1c1
Sequence:CCGGGAGCAGAATTTGCATAGAGTTCTCGAGAACTCTATGCAAATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053255.2-1697s1c1
Sequence:CCGGCTTAGCACTTTGTTCAACATTCTCGAGAATGTTGAACAAAGTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018696
ELAC1 MISSION shRNA Bacterial Glycerol Stock
elaC ribonuclease Z 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000051824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-650s1c1
Sequence:CCGGGCACAGAAACTTAAAGACCTTCTCGAGAAGGTCTTTAAGTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-302s1c1
Sequence:CCGGGTGTCCAAACAGCCTATTGAACTCGAGTTCAATAGGCTGTTTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-542s1c1
Sequence:CCGGCTTCTGTTTGATGATGAACAACTCGAGTTGTTCATCATCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018696
ELAC1 MISSION shRNA shRNA Plasmid DNA
elaC ribonuclease Z 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000051824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-650s1c1
Sequence:CCGGGCACAGAAACTTAAAGACCTTCTCGAGAAGGTCTTTAAGTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-302s1c1
Sequence:CCGGGTGTCCAAACAGCCTATTGAACTCGAGTTCAATAGGCTGTTTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-542s1c1
Sequence:CCGGCTTCTGTTTGATGATGAACAACTCGAGTTGTTCATCATCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018696
ELAC1 MISSION shRNA Lentiviral Transduction Particles
elaC ribonuclease Z 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000051824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-650s1c1
Sequence:CCGGGCACAGAAACTTAAAGACCTTCTCGAGAAGGTCTTTAAGTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-302s1c1
Sequence:CCGGGTGTCCAAACAGCCTATTGAACTCGAGTTCAATAGGCTGTTTGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018696.1-542s1c1
Sequence:CCGGCTTCTGTTTGATGATGAACAACTCGAGTTGTTCATCATCAAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks