EMAIL THIS PAGE TO A FRIEND

ELAC2

elaC ribonuclease Z 2

52 Gene Product Result for
Synonyms: ELC2 HPC2
UniProtKB ID: Q9BQ52, B4DPL9, Q6IA94, Q9HAS8, Q9HAS9, Q9NVT1
Gene ID:
Human(60528) Summary: The protein encoded by this gene has a C-terminal domain with tRNA 3' processing endoribonuclease activity, which catalyzes the removal of the 3' trailer from precursor tRNAs. The protein also interacts with activated Smad family member 2 (Smad2) and its nuclear partner forkhead box H1 (also known as FAST-1), and reduced expression can suppress transforming growth factor-beta induced growth arrest. Mutations in this gene result in an increased risk of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(68626) elaC homolog 2 (E. coli)
Rat(282826) elaC ribonuclease Z 2
naked mole-rat(101723360) elaC ribonuclease Z 2
domestic guinea pig(100732820) elaC ribonuclease Z 2
sheep(101104921) elaC homolog 2 (E. coli)
Domestic Rabbit(100342150) elaC homolog 2 (E. coli)
Zebrafish(492652) elaC homolog 2 (E. coli)
chicken(417313) elaC homolog 2 (E. coli)
domestic cat(101087182) elaC homolog 2 (E. coli)
cow(509256) elaC homolog 2 (E. coli)
dog(489511) elaC homolog 2 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018127 Rosetta Predictions human pricing
NM_172326 Rosetta Predictions rat pricing
NM_023479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155991 predicted 2235
2 SASI_Hs01_00155992 predicted 2309
3 SASI_Hs01_00155993 predicted 1755
4 SASI_Hs01_00155995 predicted 1894
5 SASI_Hs01_00155996 predicted 406
6 SASI_Hs01_00155997 predicted 1048
7 SASI_Hs01_00155999 predicted 1521
8 SASI_Hs02_00351338 predicted 363
9 SASI_Hs02_00351339 predicted 326
10 SASI_Hs02_00351340 predicted 1295
11 SASI_Hs01_00155990 predicted 824
12 SASI_Hs01_00155994 predicted 434
13 SASI_Hs01_00155998 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040082 predicted 317
2 SASI_Rn01_00040083 predicted 1663
3 SASI_Rn01_00040084 predicted 1374
4 SASI_Rn01_00040085 predicted 1261
5 SASI_Rn01_00040086 predicted 1618
6 SASI_Rn01_00040087 predicted 274
7 SASI_Rn01_00040088 predicted 1947
8 SASI_Rn01_00040089 predicted 1535
9 SASI_Rn01_00040090 predicted 1013
10 SASI_Rn01_00040091 predicted 2273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132541 predicted 261
2 SASI_Mm01_00132542 predicted 753
3 SASI_Mm01_00132543 predicted 954
4 SASI_Mm01_00132544 predicted 1321
5 SASI_Mm01_00132545 predicted 1444
6 SASI_Mm01_00132546 predicted 1584
7 SASI_Mm01_00132547 predicted 2217
8 SASI_Mm01_00132548 predicted 1307
9 SASI_Mm01_00132549 predicted 1030
10 SASI_Mm02_00327135 predicted 543
11 SASI_Mm01_00132550 predicted 1892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018127
VALIDATED
ELAC2 MISSION shRNA Bacterial Glycerol Stock
elaC ribonuclease Z 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018127.4-983s1c1
Sequence:CCGGTGGTAGAATGTCCAGATGAAACTCGAGTTTCATCTGGACATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018127.4-394s1c1
Sequence:CCGGCGAATGCACTGGTCTAATGTTCTCGAGAACATTAGACCAGTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018127.4-1559s1c1
Sequence:CCGGGTGCCACACTTGTCAACATAACTCGAGTTATGTTGACAAGTGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-400s21c1
Sequence:CCGGTTGCTCGCCTGGACAACATATCTCGAGATATGTTGTCCAGGCGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-2243s21c1
Sequence:CCGGCGCGGAGTTCATTATGCTGAACTCGAGTTCAGCATAATGAACTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018127.5-1018s21c1
Sequence:CCGGTGGTAGAATGTCCAGATGAAACTCGAGTTTCATCTGGACATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-429s21c1
Sequence:CCGGCGAATGCACTGGTCTAATGTTCTCGAGAACATTAGACCAGTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018127.5-2808s21c1
Sequence:CCGGAGCAAGCAGATGAACTAATTTCTCGAGAAATTAGTTCATCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018127
VALIDATED
ELAC2 MISSION shRNA shRNA Plasmid DNA
elaC ribonuclease Z 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018127.4-983s1c1
Sequence:CCGGTGGTAGAATGTCCAGATGAAACTCGAGTTTCATCTGGACATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018127.4-394s1c1
Sequence:CCGGCGAATGCACTGGTCTAATGTTCTCGAGAACATTAGACCAGTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018127.4-1559s1c1
Sequence:CCGGGTGCCACACTTGTCAACATAACTCGAGTTATGTTGACAAGTGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-400s21c1
Sequence:CCGGTTGCTCGCCTGGACAACATATCTCGAGATATGTTGTCCAGGCGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-2243s21c1
Sequence:CCGGCGCGGAGTTCATTATGCTGAACTCGAGTTCAGCATAATGAACTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018127.5-1018s21c1
Sequence:CCGGTGGTAGAATGTCCAGATGAAACTCGAGTTTCATCTGGACATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-429s21c1
Sequence:CCGGCGAATGCACTGGTCTAATGTTCTCGAGAACATTAGACCAGTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018127.5-2808s21c1
Sequence:CCGGAGCAAGCAGATGAACTAATTTCTCGAGAAATTAGTTCATCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018127
VALIDATED
ELAC2 MISSION shRNA Lentiviral Transduction Particles
elaC ribonuclease Z 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018127.4-983s1c1
Sequence:CCGGTGGTAGAATGTCCAGATGAAACTCGAGTTTCATCTGGACATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018127.4-394s1c1
Sequence:CCGGCGAATGCACTGGTCTAATGTTCTCGAGAACATTAGACCAGTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018127.4-1559s1c1
Sequence:CCGGGTGCCACACTTGTCAACATAACTCGAGTTATGTTGACAAGTGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-400s21c1
Sequence:CCGGTTGCTCGCCTGGACAACATATCTCGAGATATGTTGTCCAGGCGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-2243s21c1
Sequence:CCGGCGCGGAGTTCATTATGCTGAACTCGAGTTCAGCATAATGAACTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018127.5-1018s21c1
Sequence:CCGGTGGTAGAATGTCCAGATGAAACTCGAGTTTCATCTGGACATTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018127.5-429s21c1
Sequence:CCGGCGAATGCACTGGTCTAATGTTCTCGAGAACATTAGACCAGTGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018127.5-2808s21c1
Sequence:CCGGAGCAAGCAGATGAACTAATTTCTCGAGAAATTAGTTCATCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023479
VALIDATED
ELAC2 MISSION shRNA Bacterial Glycerol Stock
elaC ribonuclease Z 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1805s1c1
Sequence:CCGGCGTCAGTATGATTCCTGCCAACTCGAGTTGGCAGGAATCATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1577s1c1
Sequence:CCGGCCGTCATTACGGACAGCAAATCTCGAGATTTGCTGTCCGTAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1806s1c1
Sequence:CCGGGTCAGTATGATTCCTGCCAAACTCGAGTTTGGCAGGAATCATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1576s1c1
Sequence:CCGGGCCGTCATTACGGACAGCAAACTCGAGTTTGCTGTCCGTAATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-267s1c1
Sequence:CCGGCGACTTATGCAGGAACACAAACTCGAGTTTGTGTTCCTGCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-2112s21c1
Sequence:CCGGACCACCTCCCAGGCCATTAATCTCGAGATTAATGGCCTGGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-321s21c1
Sequence:CCGGACTCGGATGCATTGGTCAAATCTCGAGATTTGACCAATGCATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-1577s21c1
Sequence:CCGGCCGTCATTACGGACAGCAAATCTCGAGATTTGCTGTCCGTAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-1806s21c2
Sequence:CCGGGTCAGTATGATTCCTGCCAAACTCGAGTTTGGCAGGAATCATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-267s21c2
Sequence:CCGGCGACTTATGCAGGAACACAAACTCGAGTTTGTGTTCCTGCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023479
VALIDATED
ELAC2 MISSION shRNA shRNA Plasmid DNA
elaC ribonuclease Z 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1805s1c1
Sequence:CCGGCGTCAGTATGATTCCTGCCAACTCGAGTTGGCAGGAATCATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1577s1c1
Sequence:CCGGCCGTCATTACGGACAGCAAATCTCGAGATTTGCTGTCCGTAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1806s1c1
Sequence:CCGGGTCAGTATGATTCCTGCCAAACTCGAGTTTGGCAGGAATCATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1576s1c1
Sequence:CCGGGCCGTCATTACGGACAGCAAACTCGAGTTTGCTGTCCGTAATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-267s1c1
Sequence:CCGGCGACTTATGCAGGAACACAAACTCGAGTTTGTGTTCCTGCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-2112s21c1
Sequence:CCGGACCACCTCCCAGGCCATTAATCTCGAGATTAATGGCCTGGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-321s21c1
Sequence:CCGGACTCGGATGCATTGGTCAAATCTCGAGATTTGACCAATGCATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-1577s21c1
Sequence:CCGGCCGTCATTACGGACAGCAAATCTCGAGATTTGCTGTCCGTAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-1806s21c2
Sequence:CCGGGTCAGTATGATTCCTGCCAAACTCGAGTTTGGCAGGAATCATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-267s21c2
Sequence:CCGGCGACTTATGCAGGAACACAAACTCGAGTTTGTGTTCCTGCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023479
VALIDATED
ELAC2 MISSION shRNA Lentiviral Transduction Particles
elaC ribonuclease Z 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1805s1c1
Sequence:CCGGCGTCAGTATGATTCCTGCCAACTCGAGTTGGCAGGAATCATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1577s1c1
Sequence:CCGGCCGTCATTACGGACAGCAAATCTCGAGATTTGCTGTCCGTAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1806s1c1
Sequence:CCGGGTCAGTATGATTCCTGCCAAACTCGAGTTTGGCAGGAATCATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-1576s1c1
Sequence:CCGGGCCGTCATTACGGACAGCAAACTCGAGTTTGCTGTCCGTAATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023479.1-267s1c1
Sequence:CCGGCGACTTATGCAGGAACACAAACTCGAGTTTGTGTTCCTGCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-2112s21c1
Sequence:CCGGACCACCTCCCAGGCCATTAATCTCGAGATTAATGGCCTGGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-321s21c1
Sequence:CCGGACTCGGATGCATTGGTCAAATCTCGAGATTTGACCAATGCATCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-1577s21c1
Sequence:CCGGCCGTCATTACGGACAGCAAATCTCGAGATTTGCTGTCCGTAATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-1806s21c2
Sequence:CCGGGTCAGTATGATTCCTGCCAAACTCGAGTTTGGCAGGAATCATACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023479.1-267s21c2
Sequence:CCGGCGACTTATGCAGGAACACAAACTCGAGTTTGTGTTCCTGCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks