EMAIL THIS PAGE TO A FRIEND

ELANE

elastase, neutrophil expressed

79 Gene Product Result for
Synonyms: ELA2 GE HLE HNE NE PMN-E SCN1
UniProtKB ID: P08246, P09649, Q6B0D9, Q6LDP5
Gene ID:
Human(1991) Summary: Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins. The product of this gene hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. The enzyme may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. This protein degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Mutations in this gene are associated with cyclic neutropenia and severe congenital neutropenia (SCN). This gene is clustered with other serine protease gene family members, azurocidin 1 and proteinase 3 genes, at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. [provided by RefSeq, May 2009]
Mouse(50701) elastase, neutrophil expressed
Rat(299606) elastase, neutrophil expressed
sheep(101110841) elastase, neutrophil expressed
domestic guinea pig(100724414) elastase, neutrophil expressed
cow(100126050) elastase, neutrophil expressed
Horse(100462967) elastase, neutrophil expressed
domestic cat(100301482) elastase, neutrophil expressed
dog(442980) elastase, neutrophil expressed
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK213 Neutrophil Elastase Inhibitor Screening Kit Sufficient for 100 Fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003711 MISSION® esiRNA esiRNA targeting human ELA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001972 Rosetta Predictions human pricing
NM_001106767 Rosetta Predictions rat pricing
XM_234883 Rosetta Predictions rat pricing
NM_015779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216493 predicted 238
2 SASI_Hs01_00216494 predicted 234
3 SASI_Hs01_00216495 predicted 329
4 SASI_Hs01_00216497 predicted 368
5 SASI_Hs01_00216498 predicted 314
6 SASI_Hs01_00216499 predicted 400
7 SASI_Hs01_00216500 predicted 663
8 SASI_Hs01_00216501 predicted 199
9 SASI_Hs01_00216502 predicted 375
10 SASI_Hs02_00332942 predicted 308
11 SASI_Hs01_00216496 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222198 predicted 229
2 SASI_Rn02_00222199 predicted 385
3 SASI_Rn02_00222200 predicted 217
4 SASI_Rn02_00222201 predicted 348
5 SASI_Rn02_00222202 predicted 392
6 SASI_Rn02_00222203 predicted 449
7 SASI_Rn02_00222204 predicted 643
8 SASI_Rn02_00222205 predicted 524
9 SASI_Rn02_00222206 predicted 400
10 SASI_Rn02_00222207 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136671 predicted 206
2 SASI_Rn01_00136672 predicted 365
3 SASI_Rn01_00136673 predicted 333
4 SASI_Rn01_00136674 predicted 208
5 SASI_Rn01_00136675 predicted 329
6 SASI_Rn01_00136676 predicted 369
7 SASI_Rn01_00136677 predicted 506
8 SASI_Rn01_00136678 predicted 434
9 SASI_Rn01_00136679 predicted 620
10 SASI_Rn01_00136680 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021470 predicted 274
2 SASI_Mm01_00021471 predicted 376
3 SASI_Mm02_00323120 predicted 536
4 SASI_Mm02_00323121 predicted 284
5 SASI_Mm02_00323122 predicted 227
6 SASI_Mm02_00323123 predicted 336
7 SASI_Mm01_00021474 predicted 344
8 SASI_Mm02_00323124 predicted 240
9 SASI_Mm02_00323125 predicted 258
10 SASI_Mm01_00021478 predicted 568
11 SASI_Mm01_00021469 predicted 210
12 SASI_Mm01_00021472 predicted 480
13 SASI_Mm01_00021473 predicted 315
14 SASI_Mm01_00021475 predicted 221
15 SASI_Mm01_00021476 predicted 205
16 SASI_Mm01_00021477 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001972
ELANE MISSION shRNA Bacterial Glycerol Stock
elastase, neutrophil expressed
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-379s21c1
Sequence:CCGGTGCTCAACGACATCGTGATTCCTCGAGGAATCACGATGTCGTTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-550s21c1
Sequence:CCGGAGCTCAACGTGACGGTGGTGACTCGAGTCACCACCGTCACGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-245s21c1
Sequence:CCGGGCACTGCGTGGCGAATGTAAACTCGAGTTTACATTCGCCACGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-662s1c1
Sequence:CCGGCAACGGGCTAATCCACGGAATCTCGAGATTCCGTGGATTAGCCCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001972.x-889s1c1
Sequence:CCGGGCATCTGGCACAATAAACATTCTCGAGAATGTTTATTGTGCCAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-661s1c1
Sequence:CCGGGCAACGGGCTAATCCACGGAACTCGAGTTCCGTGGATTAGCCCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-767s1c1
Sequence:CCGGCTCTATCATCCAACGCTCCGACTCGAGTCGGAGCGTTGGATGATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001972
ELANE MISSION shRNA shRNA Plasmid DNA
elastase, neutrophil expressed
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-379s21c1
Sequence:CCGGTGCTCAACGACATCGTGATTCCTCGAGGAATCACGATGTCGTTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-550s21c1
Sequence:CCGGAGCTCAACGTGACGGTGGTGACTCGAGTCACCACCGTCACGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-245s21c1
Sequence:CCGGGCACTGCGTGGCGAATGTAAACTCGAGTTTACATTCGCCACGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-662s1c1
Sequence:CCGGCAACGGGCTAATCCACGGAATCTCGAGATTCCGTGGATTAGCCCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001972.x-889s1c1
Sequence:CCGGGCATCTGGCACAATAAACATTCTCGAGAATGTTTATTGTGCCAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-661s1c1
Sequence:CCGGGCAACGGGCTAATCCACGGAACTCGAGTTCCGTGGATTAGCCCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-767s1c1
Sequence:CCGGCTCTATCATCCAACGCTCCGACTCGAGTCGGAGCGTTGGATGATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001972
ELANE MISSION shRNA Lentiviral Transduction Particles
elastase, neutrophil expressed
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-379s21c1
Sequence:CCGGTGCTCAACGACATCGTGATTCCTCGAGGAATCACGATGTCGTTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-550s21c1
Sequence:CCGGAGCTCAACGTGACGGTGGTGACTCGAGTCACCACCGTCACGTTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001972.2-245s21c1
Sequence:CCGGGCACTGCGTGGCGAATGTAAACTCGAGTTTACATTCGCCACGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-662s1c1
Sequence:CCGGCAACGGGCTAATCCACGGAATCTCGAGATTCCGTGGATTAGCCCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001972.x-889s1c1
Sequence:CCGGGCATCTGGCACAATAAACATTCTCGAGAATGTTTATTGTGCCAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-661s1c1
Sequence:CCGGGCAACGGGCTAATCCACGGAACTCGAGTTCCGTGGATTAGCCCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001972.x-767s1c1
Sequence:CCGGCTCTATCATCCAACGCTCCGACTCGAGTCGGAGCGTTGGATGATAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015779
ELANE MISSION shRNA Bacterial Glycerol Stock
elastase, neutrophil expressed
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015779.2-767s21c1
Sequence:CCGGCCATAATGACCACCTTCTTACCTCGAGGTAAGAAGGTGGTCATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-204s1c1
Sequence:CCGGCCATTGTGTGAACGGTCTAAACTCGAGTTTAGACCGTTCACACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-339s1c1
Sequence:CCGGGCTGAACGACATTGTGATTATCTCGAGATAATCACAATGTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-613s1c1
Sequence:CCGGCCCTTGGTCTGTAACAACCTTCTCGAGAAGGTTGTTACAGACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-36s1c1
Sequence:CCGGTGCCATGCTACTGGCATTGTTCTCGAGAACAATGCCAGTAGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-496s1c1
Sequence:CCGGAGTGTGCTACAAGAGCTCAATCTCGAGATTGAGCTCTTGTAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015779
ELANE MISSION shRNA shRNA Plasmid DNA
elastase, neutrophil expressed
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015779.2-767s21c1
Sequence:CCGGCCATAATGACCACCTTCTTACCTCGAGGTAAGAAGGTGGTCATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-204s1c1
Sequence:CCGGCCATTGTGTGAACGGTCTAAACTCGAGTTTAGACCGTTCACACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-339s1c1
Sequence:CCGGGCTGAACGACATTGTGATTATCTCGAGATAATCACAATGTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-613s1c1
Sequence:CCGGCCCTTGGTCTGTAACAACCTTCTCGAGAAGGTTGTTACAGACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-36s1c1
Sequence:CCGGTGCCATGCTACTGGCATTGTTCTCGAGAACAATGCCAGTAGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-496s1c1
Sequence:CCGGAGTGTGCTACAAGAGCTCAATCTCGAGATTGAGCTCTTGTAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015779
ELANE MISSION shRNA Lentiviral Transduction Particles
elastase, neutrophil expressed
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015779.2-767s21c1
Sequence:CCGGCCATAATGACCACCTTCTTACCTCGAGGTAAGAAGGTGGTCATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-204s1c1
Sequence:CCGGCCATTGTGTGAACGGTCTAAACTCGAGTTTAGACCGTTCACACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-339s1c1
Sequence:CCGGGCTGAACGACATTGTGATTATCTCGAGATAATCACAATGTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-613s1c1
Sequence:CCGGCCCTTGGTCTGTAACAACCTTCTCGAGAAGGTTGTTACAGACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-36s1c1
Sequence:CCGGTGCCATGCTACTGGCATTGTTCTCGAGAACAATGCCAGTAGCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015779.1-496s1c1
Sequence:CCGGAGTGTGCTACAAGAGCTCAATCTCGAGATTGAGCTCTTGTAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks