EMAIL THIS PAGE TO A FRIEND

ELAVL1

ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)

193 Gene Product Result for
Synonyms: ELAV1 HUR Hua MelG
UniProtKB ID: Q15717, Q53XN6, Q9BTT1
Gene ID:
Human(1994) Summary: The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]
Mouse(15568) ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
Rat(363854) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Zebrafish(30736) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
chicken(395637) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
dog(611201) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
domestic cat(101094402) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
cow(617316) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Horse(100060819) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
sheep(100307040) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Domestic Rabbit(100353220) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
domestic guinea pig(100735972) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
naked mole-rat(101713794) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001419 Rosetta Predictions human pricing
NM_001108848 Rosetta Predictions rat pricing
NM_010485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049654 predicted 404
2 SASI_Hs01_00049655 predicted 1432
3 SASI_Hs01_00049656 predicted 1445
4 SASI_Hs01_00049657 predicted 548
5 SASI_Hs01_00049658 predicted 642
6 SASI_Hs01_00049659 predicted 545
7 SASI_Hs01_00049660 predicted 1581
8 SASI_Hs01_00049661 predicted 1461
9 SASI_Hs01_00049662 predicted 608
10 SASI_Hs01_00049663 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242675 predicted 700
2 SASI_Rn02_00242676 predicted 633
3 SASI_Rn02_00242677 predicted 776
4 SASI_Rn02_00242678 predicted 462
5 SASI_Rn02_00242679 predicted 443
6 SASI_Rn02_00242680 predicted 531
7 SASI_Rn02_00242681 predicted 398
8 SASI_Rn02_00242682 predicted 552
9 SASI_Rn02_00242683 predicted 768
10 SASI_Rn02_00242684 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318722 predicted 344
2 SASI_Mm02_00318723 predicted 712
3 SASI_Mm01_00091159 predicted 368
4 SASI_Mm01_00091160 predicted 528
5 SASI_Mm02_00318724 predicted 402
6 SASI_Mm01_00091161 predicted 385
7 SASI_Mm01_00091162 predicted 501
8 SASI_Mm01_00091163 predicted 379
9 SASI_Mm02_00318725 predicted 605
10 SASI_Mm01_00091165 predicted 347
11 SASI_Mm01_00091158 predicted 269
12 SASI_Mm01_00091164 predicted 280
13 SASI_Mm01_00091166 predicted 462
14 SASI_Mm01_00091167 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001419
VALIDATED
ELAVL1 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-581s1c1
Sequence:CCGGCGTGGATCAGACTACAGGTTTCTCGAGAAACCTGTAGTCTGATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-699s1c1
Sequence:CCGGCCCATCACAGTGAAGTTTGCACTCGAGTGCAAACTTCACTGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-289s1c1
Sequence:CCGGGCAGCATTGGTGAAGTTGAATCTCGAGATTCAACTTCACCAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001419.2-1038s1c1
Sequence:CCGGACCATGACAAACTATGAAGAACTCGAGTTCTTCATAGTTTGTCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-221s1c1
Sequence:CCGGGAGAACGAATTTGATCGTCAACTCGAGTTGACGATCAAATTCGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-699s21c1
Sequence:CCGGCCCATCACAGTGAAGTTTGCACTCGAGTGCAAACTTCACTGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-1210s21c1
Sequence:CCGGTTGTTAGTGTACAACTCATTTCTCGAGAAATGAGTTGTACACTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-460s21c1
Sequence:CCGGCGAGCTCAGAGGTGATCAAAGCTCGAGCTTTGATCACCTCTGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-659s21c1
Sequence:CCGGTACCAGTTTCAATGGTCATAACTCGAGTTATGACCATTGAAACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-289s21c1
Sequence:CCGGGCAGCATTGGTGAAGTTGAATCTCGAGATTCAACTTCACCAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001419
VALIDATED
ELAVL1 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-581s1c1
Sequence:CCGGCGTGGATCAGACTACAGGTTTCTCGAGAAACCTGTAGTCTGATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-699s1c1
Sequence:CCGGCCCATCACAGTGAAGTTTGCACTCGAGTGCAAACTTCACTGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-289s1c1
Sequence:CCGGGCAGCATTGGTGAAGTTGAATCTCGAGATTCAACTTCACCAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001419.2-1038s1c1
Sequence:CCGGACCATGACAAACTATGAAGAACTCGAGTTCTTCATAGTTTGTCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-221s1c1
Sequence:CCGGGAGAACGAATTTGATCGTCAACTCGAGTTGACGATCAAATTCGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-699s21c1
Sequence:CCGGCCCATCACAGTGAAGTTTGCACTCGAGTGCAAACTTCACTGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-1210s21c1
Sequence:CCGGTTGTTAGTGTACAACTCATTTCTCGAGAAATGAGTTGTACACTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-460s21c1
Sequence:CCGGCGAGCTCAGAGGTGATCAAAGCTCGAGCTTTGATCACCTCTGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-659s21c1
Sequence:CCGGTACCAGTTTCAATGGTCATAACTCGAGTTATGACCATTGAAACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-289s21c1
Sequence:CCGGGCAGCATTGGTGAAGTTGAATCTCGAGATTCAACTTCACCAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001419
VALIDATED
ELAVL1 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-581s1c1
Sequence:CCGGCGTGGATCAGACTACAGGTTTCTCGAGAAACCTGTAGTCTGATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-699s1c1
Sequence:CCGGCCCATCACAGTGAAGTTTGCACTCGAGTGCAAACTTCACTGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-289s1c1
Sequence:CCGGGCAGCATTGGTGAAGTTGAATCTCGAGATTCAACTTCACCAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001419.2-1038s1c1
Sequence:CCGGACCATGACAAACTATGAAGAACTCGAGTTCTTCATAGTTTGTCATGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001419.2-221s1c1
Sequence:CCGGGAGAACGAATTTGATCGTCAACTCGAGTTGACGATCAAATTCGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-699s21c1
Sequence:CCGGCCCATCACAGTGAAGTTTGCACTCGAGTGCAAACTTCACTGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-1210s21c1
Sequence:CCGGTTGTTAGTGTACAACTCATTTCTCGAGAAATGAGTTGTACACTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-460s21c1
Sequence:CCGGCGAGCTCAGAGGTGATCAAAGCTCGAGCTTTGATCACCTCTGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-659s21c1
Sequence:CCGGTACCAGTTTCAATGGTCATAACTCGAGTTATGACCATTGAAACTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001419.2-289s21c1
Sequence:CCGGGCAGCATTGGTGAAGTTGAATCTCGAGATTCAACTTCACCAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010485
ELAVL1 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-354s1c1
Sequence:CCGGCGAGGTTGAATCTGCAAAGCTCTCGAGAGCTTTGCAGATTCAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010485.2-1423s1c1
Sequence:CCGGCCCACAAATGTTAGACCAATTCTCGAGAATTGGTCTAACATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-270s1c1
Sequence:CCGGCATTGGGAGAACGAATTTAATCTCGAGATTAAATTCGTTCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-775s1c1
Sequence:CCGGGCCAATCCCAACCAGAACAAACTCGAGTTTGTTCTGGTTGGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-363s21c1
Sequence:CCGGCGAGGTTGAATCTGCAAAGCTCTCGAGAGCTTTGCAGATTCAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-279s21c1
Sequence:CCGGCATTGGGAGAACGAATTTAATCTCGAGATTAAATTCGTTCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-784s21c1
Sequence:CCGGGCCAATCCCAACCAGAACAAACTCGAGTTTGTTCTGGTTGGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010485.3-1431s21c1
Sequence:CCGGCCCACAAATGTTAGACCAATTCTCGAGAATTGGTCTAACATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010485
ELAVL1 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-354s1c1
Sequence:CCGGCGAGGTTGAATCTGCAAAGCTCTCGAGAGCTTTGCAGATTCAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010485.2-1423s1c1
Sequence:CCGGCCCACAAATGTTAGACCAATTCTCGAGAATTGGTCTAACATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-270s1c1
Sequence:CCGGCATTGGGAGAACGAATTTAATCTCGAGATTAAATTCGTTCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-775s1c1
Sequence:CCGGGCCAATCCCAACCAGAACAAACTCGAGTTTGTTCTGGTTGGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-363s21c1
Sequence:CCGGCGAGGTTGAATCTGCAAAGCTCTCGAGAGCTTTGCAGATTCAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-279s21c1
Sequence:CCGGCATTGGGAGAACGAATTTAATCTCGAGATTAAATTCGTTCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-784s21c1
Sequence:CCGGGCCAATCCCAACCAGAACAAACTCGAGTTTGTTCTGGTTGGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010485.3-1431s21c1
Sequence:CCGGCCCACAAATGTTAGACCAATTCTCGAGAATTGGTCTAACATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010485
ELAVL1 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-354s1c1
Sequence:CCGGCGAGGTTGAATCTGCAAAGCTCTCGAGAGCTTTGCAGATTCAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010485.2-1423s1c1
Sequence:CCGGCCCACAAATGTTAGACCAATTCTCGAGAATTGGTCTAACATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-270s1c1
Sequence:CCGGCATTGGGAGAACGAATTTAATCTCGAGATTAAATTCGTTCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010485.2-775s1c1
Sequence:CCGGGCCAATCCCAACCAGAACAAACTCGAGTTTGTTCTGGTTGGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-363s21c1
Sequence:CCGGCGAGGTTGAATCTGCAAAGCTCTCGAGAGCTTTGCAGATTCAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-279s21c1
Sequence:CCGGCATTGGGAGAACGAATTTAATCTCGAGATTAAATTCGTTCTCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010485.3-784s21c1
Sequence:CCGGGCCAATCCCAACCAGAACAAACTCGAGTTTGTTCTGGTTGGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010485.3-1431s21c1
Sequence:CCGGCCCACAAATGTTAGACCAATTCTCGAGAATTGGTCTAACATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks