EMAIL THIS PAGE TO A FRIEND

ELAVL2

ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)

245 Gene Product Result for
Synonyms: HEL-N1 HELN1 HUB
UniProtKB ID: Q12926, D3DRK3, Q13235, Q59G15, Q8NEM4, Q9H1Q8
Gene ID:
Human(1993) Summary: The protein encoded by this gene is a neural-specific RNA-binding protein that is known to bind to several 3' UTRs, including its own and also that of FOS and ID. The encoded protein may recognize a GAAA motif in the RNA. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(15569) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Rat(286973) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
domestic guinea pig(100718550) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
sheep(101107668) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Zebrafish(431719) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
chicken(770158) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
dog(481565) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
cow(100286845) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Horse(100053407) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004432 Rosetta Predictions human pricing
NM_173309 Rosetta Predictions rat pricing
NM_010486 Rosetta Predictions mouse pricing
NM_207685 Rosetta Predictions mouse pricing
NM_207686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095534 predicted 633
2 SASI_Hs01_00095536 predicted 288
3 SASI_Hs01_00095537 predicted 720
4 SASI_Hs02_00337601 predicted 283
5 SASI_Hs01_00095538 predicted 1300
6 SASI_Hs01_00095539 predicted 1005
7 SASI_Hs01_00095540 predicted 337
8 SASI_Hs01_00095541 predicted 636
9 SASI_Hs01_00095542 predicted 807
10 SASI_Hs01_00095543 predicted 992
11 SASI_Hs01_00095535 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103400 predicted 631
2 SASI_Rn01_00103401 predicted 1293
3 SASI_Rn01_00103402 predicted 946
4 SASI_Rn01_00103403 predicted 606
5 SASI_Rn01_00103404 predicted 1041
6 SASI_Rn01_00103405 predicted 1152
7 SASI_Rn01_00103406 predicted 1020
8 SASI_Rn01_00103407 predicted 937
9 SASI_Rn02_00269401 predicted 746
10 SASI_Rn01_00103408 predicted 887
11 SASI_Rn01_00103409 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055857 predicted 1198
2 SASI_Mm02_00318726 predicted 1259
3 SASI_Mm02_00318727 predicted 1260
4 SASI_Mm01_00055858 predicted 393
5 SASI_Mm01_00055859 predicted 614
6 SASI_Mm01_00055860 predicted 539
7 SASI_Mm01_00055861 predicted 607
8 SASI_Mm01_00055862 predicted 470
9 SASI_Mm01_00055863 predicted 523
10 SASI_Mm01_00055864 predicted 521
11 SASI_Mm01_00055856 predicted 1377
12 SASI_Mm01_00055865 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180605 predicted 1310
2 SASI_Mm02_00352223 predicted 1377
3 SASI_Mm02_00352224 predicted 1368
4 SASI_Mm01_00180606 predicted 511
5 SASI_Mm01_00180607 predicted 726
6 SASI_Mm01_00180608 predicted 652
7 SASI_Mm01_00180609 predicted 717
8 SASI_Mm01_00180610 predicted 586
9 SASI_Mm01_00180611 predicted 639
10 SASI_Mm01_00180612 predicted 636
11 SASI_Mm01_00180604 predicted 1486
12 SASI_Mm01_00180613 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152740 predicted 1160
2 SASI_Mm02_00352225 predicted 1223
3 SASI_Mm02_00352226 predicted 1223
4 SASI_Mm01_00152741 predicted 397
5 SASI_Mm01_00152742 predicted 618
6 SASI_Mm01_00152743 predicted 532
7 SASI_Mm01_00152744 predicted 605
8 SASI_Mm01_00152745 predicted 472
9 SASI_Mm01_00152746 predicted 532
10 SASI_Mm01_00152747 predicted 529
11 SASI_Mm01_00152739 predicted 1328
12 SASI_Mm01_00152748 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004432
VALIDATED
ELAVL2 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-787s21c1
Sequence:CCGGTTCGATTTGACAAGCGAATTGCTCGAGCAATTCGCTTGTCAAATCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004432.3-1360s21c1
Sequence:CCGGCTCTTGTCCTCAGTCCATTTACTCGAGTAAATGGACTGAGGACAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-989s21c1
Sequence:CCGGGTTGGACAATCTGCTCAATATCTCGAGATATTGAGCAGATTGTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-816s21c1
Sequence:CCGGGAAGCTATCAAAGGCCTAAATCTCGAGATTTAGGCCTTTGATAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004432.1-1032s1c1
Sequence:CCGGCGCATTATTACTTCTCGTATTCTCGAGAATACGAGAAGTAATAATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1629s1c1
Sequence:CCGGGTCTCCTTTAAGACAAACAAACTCGAGTTTGTTTGTCTTAAAGGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-942s1c1
Sequence:CCGGGCTTCTATCAGAGATGCAAATCTCGAGATTTGCATCTCTGATAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1508s1c1
Sequence:CCGGCCGTGACTTTAACACCAATAACTCGAGTTATTGGTGTTAAAGTCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1320s1c1
Sequence:CCGGGCTTATGGAGTAAAGAGGTTTCTCGAGAAACCTCTTTACTCCATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004432
VALIDATED
ELAVL2 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-787s21c1
Sequence:CCGGTTCGATTTGACAAGCGAATTGCTCGAGCAATTCGCTTGTCAAATCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004432.3-1360s21c1
Sequence:CCGGCTCTTGTCCTCAGTCCATTTACTCGAGTAAATGGACTGAGGACAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-989s21c1
Sequence:CCGGGTTGGACAATCTGCTCAATATCTCGAGATATTGAGCAGATTGTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-816s21c1
Sequence:CCGGGAAGCTATCAAAGGCCTAAATCTCGAGATTTAGGCCTTTGATAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004432.1-1032s1c1
Sequence:CCGGCGCATTATTACTTCTCGTATTCTCGAGAATACGAGAAGTAATAATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1629s1c1
Sequence:CCGGGTCTCCTTTAAGACAAACAAACTCGAGTTTGTTTGTCTTAAAGGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-942s1c1
Sequence:CCGGGCTTCTATCAGAGATGCAAATCTCGAGATTTGCATCTCTGATAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1508s1c1
Sequence:CCGGCCGTGACTTTAACACCAATAACTCGAGTTATTGGTGTTAAAGTCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1320s1c1
Sequence:CCGGGCTTATGGAGTAAAGAGGTTTCTCGAGAAACCTCTTTACTCCATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004432
VALIDATED
ELAVL2 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-787s21c1
Sequence:CCGGTTCGATTTGACAAGCGAATTGCTCGAGCAATTCGCTTGTCAAATCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004432.3-1360s21c1
Sequence:CCGGCTCTTGTCCTCAGTCCATTTACTCGAGTAAATGGACTGAGGACAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-989s21c1
Sequence:CCGGGTTGGACAATCTGCTCAATATCTCGAGATATTGAGCAGATTGTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004432.3-816s21c1
Sequence:CCGGGAAGCTATCAAAGGCCTAAATCTCGAGATTTAGGCCTTTGATAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004432.1-1032s1c1
Sequence:CCGGCGCATTATTACTTCTCGTATTCTCGAGAATACGAGAAGTAATAATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1629s1c1
Sequence:CCGGGTCTCCTTTAAGACAAACAAACTCGAGTTTGTTTGTCTTAAAGGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-942s1c1
Sequence:CCGGGCTTCTATCAGAGATGCAAATCTCGAGATTTGCATCTCTGATAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1508s1c1
Sequence:CCGGCCGTGACTTTAACACCAATAACTCGAGTTATTGGTGTTAAAGTCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004432.1-1320s1c1
Sequence:CCGGGCTTATGGAGTAAAGAGGTTTCTCGAGAAACCTCTTTACTCCATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207686
VALIDATED
ELAVL2 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207686.1-1176s21c1
Sequence:CCGGGCAGGTCTCCTTTAAGACAAACTCGAGTTTGTCTTAAAGGAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207686.1-216s21c1
Sequence:CCGGCAATGGTCCAACCACTGTAAACTCGAGTTTACAGTGGTTGGACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207686.1-1220s21c1
Sequence:CCGGCTCTTGTCCTCAGTCCATTTACTCGAGTAAATGGACTGAGGACAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207686.1-670s21c1
Sequence:CCGGGGTGTAGGGTTTATTCGATTTCTCGAGAAATCGAATAAACCCTACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207686.1-712s21c1
Sequence:CCGGGAAGCTATCAAAGGCCTAAATCTCGAGATTTAGGCCTTTGATAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-1176s1c1
Sequence:CCGGGCAGGTCTCCTTTAAGACAAACTCGAGTTTGTCTTAAAGGAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-216s1c1
Sequence:CCGGCAATGGTCCAACCACTGTAAACTCGAGTTTACAGTGGTTGGACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-986s1c1
Sequence:CCGGCGCCTGATGCAGATGAAAGTACTCGAGTACTTTCATCTGCATCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-453s1c1
Sequence:CCGGGAAAGCTATCAACACTCTGAACTCGAGTTCAGAGTGTTGATAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207686
VALIDATED
ELAVL2 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207686.1-1176s21c1
Sequence:CCGGGCAGGTCTCCTTTAAGACAAACTCGAGTTTGTCTTAAAGGAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207686.1-216s21c1
Sequence:CCGGCAATGGTCCAACCACTGTAAACTCGAGTTTACAGTGGTTGGACCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207686.1-1220s21c1
Sequence:CCGGCTCTTGTCCTCAGTCCATTTACTCGAGTAAATGGACTGAGGACAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207686.1-670s21c1
Sequence:CCGGGGTGTAGGGTTTATTCGATTTCTCGAGAAATCGAATAAACCCTACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207686.1-712s21c1
Sequence:CCGGGAAGCTATCAAAGGCCTAAATCTCGAGATTTAGGCCTTTGATAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-1176s1c1
Sequence:CCGGGCAGGTCTCCTTTAAGACAAACTCGAGTTTGTCTTAAAGGAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-216s1c1
Sequence:CCGGCAATGGTCCAACCACTGTAAACTCGAGTTTACAGTGGTTGGACCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-986s1c1
Sequence:CCGGCGCCTGATGCAGATGAAAGTACTCGAGTACTTTCATCTGCATCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-453s1c1
Sequence:CCGGGAAAGCTATCAACACTCTGAACTCGAGTTCAGAGTGTTGATAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207686
VALIDATED
ELAVL2 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207686.1-1176s21c1
Sequence:CCGGGCAGGTCTCCTTTAAGACAAACTCGAGTTTGTCTTAAAGGAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207686.1-216s21c1
Sequence:CCGGCAATGGTCCAACCACTGTAAACTCGAGTTTACAGTGGTTGGACCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207686.1-1220s21c1
Sequence:CCGGCTCTTGTCCTCAGTCCATTTACTCGAGTAAATGGACTGAGGACAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_207686.1-670s21c1
Sequence:CCGGGGTGTAGGGTTTATTCGATTTCTCGAGAAATCGAATAAACCCTACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207686.1-712s21c1
Sequence:CCGGGAAGCTATCAAAGGCCTAAATCTCGAGATTTAGGCCTTTGATAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-1176s1c1
Sequence:CCGGGCAGGTCTCCTTTAAGACAAACTCGAGTTTGTCTTAAAGGAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-216s1c1
Sequence:CCGGCAATGGTCCAACCACTGTAAACTCGAGTTTACAGTGGTTGGACCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-986s1c1
Sequence:CCGGCGCCTGATGCAGATGAAAGTACTCGAGTACTTTCATCTGCATCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_207686.1-453s1c1
Sequence:CCGGGAAAGCTATCAACACTCTGAACTCGAGTTCAGAGTGTTGATAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)