EMAIL THIS PAGE TO A FRIEND

ELAVL3

ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)

107 Gene Product Result for
Synonyms: HUC HUCL PLE21
UniProtKB ID: Q14576, Q16135, Q96CL8, Q96QS9
Gene ID:
Human(1995) Summary: A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15571) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Rat(282824) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Zebrafish(30732) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
cow(520376) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
domestic cat(101099186) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
dog(484940) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
sheep(101119719) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
domestic guinea pig(100726151) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
naked mole-rat(101715196) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053691 MISSION® esiRNA esiRNA targeting mouse Elavl3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001420 Rosetta Predictions human pricing
NM_032281 Rosetta Predictions human pricing
NM_172324 Rosetta Predictions rat pricing
NM_010487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050732 predicted 676
2 SASI_Hs01_00050733 predicted 680
3 SASI_Hs01_00050734 predicted 821
4 SASI_Hs01_00050735 predicted 736
5 SASI_Hs01_00050736 predicted 815
6 SASI_Hs01_00050737 predicted 1081
7 SASI_Hs01_00050738 predicted 1362
8 SASI_Hs01_00050739 predicted 582
9 SASI_Hs02_00331823 predicted 606
10 SASI_Hs01_00050740 predicted 590
11 SASI_Hs01_00050741 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108736 predicted 667
2 SASI_Hs01_00108737 predicted 681
3 SASI_Hs01_00108738 predicted 821
4 SASI_Hs01_00108739 predicted 735
5 SASI_Hs01_00108740 predicted 813
6 SASI_Hs01_00108741 predicted 1077
7 SASI_Hs01_00108742 predicted 1338
8 SASI_Hs01_00108743 predicted 581
9 SASI_Hs02_00359601 predicted 608
10 SASI_Hs01_00108744 predicted 592
11 SASI_Hs01_00108745 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052002 predicted 621
2 SASI_Rn01_00052004 predicted 632
3 SASI_Rn01_00052005 predicted 403
4 SASI_Rn01_00052007 predicted 472
5 SASI_Rn01_00052008 predicted 614
6 SASI_Rn01_00052009 predicted 373
7 SASI_Rn02_00269213 predicted 475
8 SASI_Rn02_00269214 predicted 688
9 SASI_Rn02_00269215 predicted 393
10 SASI_Rn02_00269216 predicted 813
11 SASI_Rn01_00052001 predicted 392
12 SASI_Rn01_00052003 predicted 334
13 SASI_Rn01_00052006 predicted 577
14 SASI_Rn01_00052010 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199491 predicted 763
2 SASI_Mm01_00199493 predicted 702
3 SASI_Mm01_00199494 predicted 1002
4 SASI_Mm01_00199495 predicted 840
5 SASI_Mm01_00199496 predicted 986
6 SASI_Mm01_00199497 predicted 841
7 SASI_Mm01_00199498 predicted 850
8 SASI_Mm01_00199499 predicted 741
9 SASI_Mm01_00199500 predicted 1254
10 SASI_Mm02_00318728 predicted 767
11 SASI_Mm01_00199492 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010487
ELAVL3 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010487.1-1932s1c1
Sequence:CCGGCCTGGCCTATACTGAGAGAAACTCGAGTTTCTCTCAGTATAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1360s1c1
Sequence:CCGGCCGAGATTTCACCACCAACAACTCGAGTTGTTGGTGGTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1124s1c1
Sequence:CCGGCGGCTGGACAATTTGCTCAATCTCGAGATTGAGCAAATTGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-858s1c1
Sequence:CCGGGCCGAATCATCACTTCCAGAACTCGAGTTCTGGAAGTGATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1126s1c1
Sequence:CCGGGCTGGACAATTTGCTCAATATCTCGAGATATTGAGCAAATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010487
ELAVL3 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010487.1-1932s1c1
Sequence:CCGGCCTGGCCTATACTGAGAGAAACTCGAGTTTCTCTCAGTATAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1360s1c1
Sequence:CCGGCCGAGATTTCACCACCAACAACTCGAGTTGTTGGTGGTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1124s1c1
Sequence:CCGGCGGCTGGACAATTTGCTCAATCTCGAGATTGAGCAAATTGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-858s1c1
Sequence:CCGGGCCGAATCATCACTTCCAGAACTCGAGTTCTGGAAGTGATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1126s1c1
Sequence:CCGGGCTGGACAATTTGCTCAATATCTCGAGATATTGAGCAAATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010487
ELAVL3 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010487.1-1932s1c1
Sequence:CCGGCCTGGCCTATACTGAGAGAAACTCGAGTTTCTCTCAGTATAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1360s1c1
Sequence:CCGGCCGAGATTTCACCACCAACAACTCGAGTTGTTGGTGGTGAAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1124s1c1
Sequence:CCGGCGGCTGGACAATTTGCTCAATCTCGAGATTGAGCAAATTGTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-858s1c1
Sequence:CCGGGCCGAATCATCACTTCCAGAACTCGAGTTCTGGAAGTGATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010487.1-1126s1c1
Sequence:CCGGGCTGGACAATTTGCTCAATATCTCGAGATATTGAGCAAATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032281
ELAVL3 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-347s1c1
Sequence:CCGGCGATAGATATTTGGACATCAACTCGAGTTGATGTCCAAATATCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-331s1c1
Sequence:CCGGGCACACGTGAATGTAGCGATACTCGAGTATCGCTACATTCACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-897s1c1
Sequence:CCGGCCCTTTCGGTTTGTTGGGTTTCTCGAGAAACCCAACAAACCGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-415s1c1
Sequence:CCGGGCAGACATATGCCCATAGCATCTCGAGATGCTATGGGCATATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-665s1c1
Sequence:CCGGCCCACAACACTTGAGGCCAAACTCGAGTTTGGCCTCAAGTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032281
ELAVL3 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-347s1c1
Sequence:CCGGCGATAGATATTTGGACATCAACTCGAGTTGATGTCCAAATATCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-331s1c1
Sequence:CCGGGCACACGTGAATGTAGCGATACTCGAGTATCGCTACATTCACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-897s1c1
Sequence:CCGGCCCTTTCGGTTTGTTGGGTTTCTCGAGAAACCCAACAAACCGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-415s1c1
Sequence:CCGGGCAGACATATGCCCATAGCATCTCGAGATGCTATGGGCATATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-665s1c1
Sequence:CCGGCCCACAACACTTGAGGCCAAACTCGAGTTTGGCCTCAAGTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032281
ELAVL3 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-347s1c1
Sequence:CCGGCGATAGATATTTGGACATCAACTCGAGTTGATGTCCAAATATCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-331s1c1
Sequence:CCGGGCACACGTGAATGTAGCGATACTCGAGTATCGCTACATTCACGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-897s1c1
Sequence:CCGGCCCTTTCGGTTTGTTGGGTTTCTCGAGAAACCCAACAAACCGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-415s1c1
Sequence:CCGGGCAGACATATGCCCATAGCATCTCGAGATGCTATGGGCATATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032281.1-665s1c1
Sequence:CCGGCCCACAACACTTGAGGCCAAACTCGAGTTTGGCCTCAAGTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001420
ELAVL3 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001420.3-3651s1c1
Sequence:CCGGCCGTGTATATTTCTGTTACTTCTCGAGAAGTAACAGAAATATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-683s1c1
Sequence:CCGGCGGCCTCAAATTACAGACGAACTCGAGTTCGTCTGTAATTTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-1449s1c1
Sequence:CCGGGTCTCCTTCAAGACCAGCAAACTCGAGTTTGCTGGTCTTGAAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-622s1c1
Sequence:CCGGGCTACGGGTTTGTGAACTATTCTCGAGAATAGTTCACAAACCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-1328s1c1
Sequence:CCGGCCGTGATTTCACCACCAACAACTCGAGTTGTTGGTGGTGAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001420
ELAVL3 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001420.3-3651s1c1
Sequence:CCGGCCGTGTATATTTCTGTTACTTCTCGAGAAGTAACAGAAATATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-683s1c1
Sequence:CCGGCGGCCTCAAATTACAGACGAACTCGAGTTCGTCTGTAATTTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-1449s1c1
Sequence:CCGGGTCTCCTTCAAGACCAGCAAACTCGAGTTTGCTGGTCTTGAAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-622s1c1
Sequence:CCGGGCTACGGGTTTGTGAACTATTCTCGAGAATAGTTCACAAACCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-1328s1c1
Sequence:CCGGCCGTGATTTCACCACCAACAACTCGAGTTGTTGGTGGTGAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001420
ELAVL3 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001420.3-3651s1c1
Sequence:CCGGCCGTGTATATTTCTGTTACTTCTCGAGAAGTAACAGAAATATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-683s1c1
Sequence:CCGGCGGCCTCAAATTACAGACGAACTCGAGTTCGTCTGTAATTTGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-1449s1c1
Sequence:CCGGGTCTCCTTCAAGACCAGCAAACTCGAGTTTGCTGGTCTTGAAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-622s1c1
Sequence:CCGGGCTACGGGTTTGTGAACTATTCTCGAGAATAGTTCACAAACCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001420.3-1328s1c1
Sequence:CCGGCCGTGATTTCACCACCAACAACTCGAGTTGTTGGTGGTGAAATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks