EMAIL THIS PAGE TO A FRIEND

ELAVL4

ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4

74 Gene Product Result for
Synonyms: HUD PNEM
Gene ID:
Mouse(15572) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
Rat(432358) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
naked mole-rat(101725151) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
domestic guinea pig(100719935) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
sheep(101107912) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Domestic Rabbit(100359216) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Zebrafish(30737) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
cow(535408) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
Horse(100051268) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
domestic cat(101090536) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
dog(475361) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
chicken(395634) ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021952 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021952 Rosetta Predictions human pricing
NM_001077651 Rosetta Predictions rat pricing
NM_001038698 Rosetta Predictions mouse pricing
NM_010488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228995 predicted 613
2 SASI_Hs01_00228996 predicted 1079
3 SASI_Hs01_00228997 predicted 530
4 SASI_Hs01_00228999 predicted 1111
5 SASI_Hs01_00229000 predicted 1184
6 SASI_Hs01_00229001 predicted 384
7 SASI_Hs01_00229002 predicted 1185
8 SASI_Hs01_00229003 predicted 446
9 SASI_Hs01_00229004 predicted 390
10 SASI_Hs02_00355278 predicted 530
11 SASI_Hs01_00228998 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207742 predicted 299
2 SASI_Rn02_00207743 predicted 1199
3 SASI_Rn02_00207744 predicted 355
4 SASI_Rn02_00207745 predicted 492
5 SASI_Rn02_00207746 predicted 369
6 SASI_Rn02_00207747 predicted 560
7 SASI_Rn02_00207748 predicted 265
8 SASI_Rn02_00207749 predicted 277
9 SASI_Rn02_00207750 predicted 404
10 SASI_Rn02_00207751 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118302 predicted 645
2 SASI_Mm01_00118303 predicted 746
3 SASI_Mm01_00118304 predicted 529
4 SASI_Mm01_00118305 predicted 867
5 SASI_Mm02_00289674 predicted 517
6 SASI_Mm01_00118307 predicted 794
7 SASI_Mm01_00118308 predicted 658
8 SASI_Mm01_00118309 predicted 738
9 SASI_Mm01_00118310 predicted 1027
10 SASI_Mm01_00118311 predicted 723
11 SASI_Mm01_00118306 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022536 predicted 726
2 SASI_Mm01_00022537 predicted 836
3 SASI_Mm01_00022538 predicted 613
4 SASI_Mm01_00022539 predicted 951
5 SASI_Mm02_00318729 predicted 607
6 SASI_Mm01_00022541 predicted 882
7 SASI_Mm01_00022542 predicted 742
8 SASI_Mm01_00022543 predicted 823
9 SASI_Mm01_00022544 predicted 1117
10 SASI_Mm01_00022545 predicted 812
11 SASI_Mm01_00022540 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010488
ELAVL4 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-714s1c1
Sequence:CCGGGCGGTGCTACAGAACCGATTACTCGAGTAATCGGTTCTGTAGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-255s1c1
Sequence:CCGGCCAACCTCATCGTCAACTATTCTCGAGAATAGTTGACGATGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-1136s1c1
Sequence:CCGGGTGTTGCAAGTTTCCTTTAAACTCGAGTTTAAAGGAAACTTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-652s1c1
Sequence:CCGGCCGCTTTGATAAGAGGATTGACTCGAGTCAATCCTCTTATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-925s1c1
Sequence:CCGGCTGGTGCATCTTCGTCTATAACTCGAGTTATAGACGAAGATGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010488
ELAVL4 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-714s1c1
Sequence:CCGGGCGGTGCTACAGAACCGATTACTCGAGTAATCGGTTCTGTAGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-255s1c1
Sequence:CCGGCCAACCTCATCGTCAACTATTCTCGAGAATAGTTGACGATGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-1136s1c1
Sequence:CCGGGTGTTGCAAGTTTCCTTTAAACTCGAGTTTAAAGGAAACTTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-652s1c1
Sequence:CCGGCCGCTTTGATAAGAGGATTGACTCGAGTCAATCCTCTTATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-925s1c1
Sequence:CCGGCTGGTGCATCTTCGTCTATAACTCGAGTTATAGACGAAGATGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010488
ELAVL4 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-714s1c1
Sequence:CCGGGCGGTGCTACAGAACCGATTACTCGAGTAATCGGTTCTGTAGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-255s1c1
Sequence:CCGGCCAACCTCATCGTCAACTATTCTCGAGAATAGTTGACGATGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-1136s1c1
Sequence:CCGGGTGTTGCAAGTTTCCTTTAAACTCGAGTTTAAAGGAAACTTGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-652s1c1
Sequence:CCGGCCGCTTTGATAAGAGGATTGACTCGAGTCAATCCTCTTATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010488.1-925s1c1
Sequence:CCGGCTGGTGCATCTTCGTCTATAACTCGAGTTATAGACGAAGATGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021952
ELAVL4 MISSION shRNA Bacterial Glycerol Stock
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-692s1c1
Sequence:CCGGCCGTATCATCACCTCACGAATCTCGAGATTCGTGAGGTGATGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-481s1c1
Sequence:CCGGGTTTAGGGTATGGATTTGTTACTCGAGTAACAAATCCATACCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-1046s1c1
Sequence:CCGGCCCAATTACCATTGATGGAATCTCGAGATTCCATCAATGGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021952.3-1149s21c1
Sequence:CCGGGAACTGGGTGGTGCATCTTTGCTCGAGCAAAGATGCACCACCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021952.3-1722s21c1
Sequence:CCGGTTACCCAGCCAGCTAACTTTACTCGAGTAAAGTTAGCTGGCTGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021952.3-1543s21c1
Sequence:CCGGAGCCAGTGTTGCCTAAGTATTCTCGAGAATACTTAGGCAACACTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021952
ELAVL4 MISSION shRNA shRNA Plasmid DNA
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-692s1c1
Sequence:CCGGCCGTATCATCACCTCACGAATCTCGAGATTCGTGAGGTGATGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-481s1c1
Sequence:CCGGGTTTAGGGTATGGATTTGTTACTCGAGTAACAAATCCATACCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-1046s1c1
Sequence:CCGGCCCAATTACCATTGATGGAATCTCGAGATTCCATCAATGGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021952.3-1149s21c1
Sequence:CCGGGAACTGGGTGGTGCATCTTTGCTCGAGCAAAGATGCACCACCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021952.3-1722s21c1
Sequence:CCGGTTACCCAGCCAGCTAACTTTACTCGAGTAAAGTTAGCTGGCTGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021952.3-1543s21c1
Sequence:CCGGAGCCAGTGTTGCCTAAGTATTCTCGAGAATACTTAGGCAACACTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021952
ELAVL4 MISSION shRNA Lentiviral Transduction Particles
ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-692s1c1
Sequence:CCGGCCGTATCATCACCTCACGAATCTCGAGATTCGTGAGGTGATGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-481s1c1
Sequence:CCGGGTTTAGGGTATGGATTTGTTACTCGAGTAACAAATCCATACCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021952.2-1046s1c1
Sequence:CCGGCCCAATTACCATTGATGGAATCTCGAGATTCCATCAATGGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021952.3-1149s21c1
Sequence:CCGGGAACTGGGTGGTGCATCTTTGCTCGAGCAAAGATGCACCACCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021952.3-1722s21c1
Sequence:CCGGTTACCCAGCCAGCTAACTTTACTCGAGTAAAGTTAGCTGGCTGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021952.3-1543s21c1
Sequence:CCGGAGCCAGTGTTGCCTAAGTATTCTCGAGAATACTTAGGCAACACTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks