EMAIL THIS PAGE TO A FRIEND

ELF1

E74-like factor 1 (ets domain transcription factor)

55 Gene Product Result for
UniProtKB ID: P32519, B4E2I5, E9PDQ9, Q8N6F6, Q9UDE1
Gene ID:
Human(1997) Summary: This gene encodes an E26 transformation-specific related transcription factor. The encoded protein is primarily expressed in lymphoid cells and acts as both an enhancer and a repressor to regulate transcription of various genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
Mouse(13709) E74-like factor 1
Rat(85424) E74-like factor 1
chicken(418828) E74-like factor 1 (ets domain transcription factor)
domestic cat(101088544) E74-like factor 1 (ets domain transcription factor)
cow(505251) E74-like factor 1 (ets domain transcription factor)
Horse(100051478) E74-like factor 1 (ets domain transcription factor)
dog(476936) E74-like factor 1 (ets domain transcription factor)
sheep(101106441) E74-like factor 1 (ets domain transcription factor)
domestic guinea pig(100735132) E74-like factor 1 (ets domain transcription factor)
naked mole-rat(101702853) E74-like factor 1 (ets domain transcription factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172373 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172373 Rosetta Predictions human pricing
NM_053520 Rosetta Predictions rat pricing
NM_007920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190347 predicted 1148
2 SASI_Hs01_00190348 predicted 1909
3 SASI_Hs01_00190350 predicted 1871
4 SASI_Hs01_00190351 predicted 473
5 SASI_Hs01_00190352 predicted 647
6 SASI_Hs01_00190353 predicted 1446
7 SASI_Hs01_00190354 predicted 1551
8 SASI_Hs01_00190355 predicted 1284
9 SASI_Hs01_00190356 predicted 996
10 SASI_Hs02_00368026 predicted 249
11 SASI_Hs01_00190349 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266131 predicted 1079
2 SASI_Rn01_00083007 predicted 948
3 SASI_Rn01_00083008 predicted 577
4 SASI_Rn01_00083009 predicted 908
5 SASI_Rn01_00083010 predicted 351
6 SASI_Rn01_00083011 predicted 1179
7 SASI_Rn01_00083012 predicted 398
8 SASI_Rn01_00083013 predicted 1564
9 SASI_Rn01_00083014 predicted 1029
10 SASI_Rn01_00083015 predicted 259
11 SASI_Rn01_00083006 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312737 predicted 701
2 SASI_Mm02_00312738 predicted 2383
3 SASI_Mm02_00312739 predicted 1834
4 SASI_Mm02_00312740 predicted 1596
5 SASI_Mm02_00312741 predicted 2299
6 SASI_Mm02_00312742 predicted 1392
7 SASI_Mm02_00312743 predicted 2317
8 SASI_Mm02_00312744 predicted 1089
9 SASI_Mm02_00312745 predicted 1028
10 SASI_Mm02_00312746 predicted 1706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007920
VALIDATED
ELF1 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 1 (ets domain transcription factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007920.3-703s21c1
Sequence:CCGGGTGTTTGAATTTGCAAGTAACCTCGAGGTTACTTGCAAATTCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-1912s21c1
Sequence:CCGGGTTCCAAGTATTAGGACTATACTCGAGTATAGTCCTAATACTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-2420s21c1
Sequence:GTACCGGAGCCTTATGTGATGGTGTTATCTCGAGATAACACCATCACATAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007920.3-3691s21c1
Sequence:GTACCGGACTATCAGGTCTGCCATAAATCTCGAGATTTATGGCAGACCTGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-1233s21c1
Sequence:CCGGCCCGACGACTACACCAAATATCTCGAGATATTTGGTGTAGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007920.2-3287s1c1
Sequence:CCGGCGCAGGTGAATTTCTGAGTTTCTCGAGAAACTCAGAAATTCACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1233s1c1
Sequence:CCGGCCCGACGACTACACCAAATATCTCGAGATATTTGGTGTAGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007920.2-2371s1c1
Sequence:CCGGGCCGAAGATGATTTGAATGAACTCGAGTTCATTCAAATCATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1713s1c1
Sequence:CCGGCGGGAATTCTAAAGCTGCAAACTCGAGTTTGCAGCTTTAGAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1712s1c1
Sequence:CCGGCCGGGAATTCTAAAGCTGCAACTCGAGTTGCAGCTTTAGAATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007920
VALIDATED
ELF1 MISSION shRNA shRNA Plasmid DNA
E74-like factor 1 (ets domain transcription factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007920.3-703s21c1
Sequence:CCGGGTGTTTGAATTTGCAAGTAACCTCGAGGTTACTTGCAAATTCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-1912s21c1
Sequence:CCGGGTTCCAAGTATTAGGACTATACTCGAGTATAGTCCTAATACTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-2420s21c1
Sequence:GTACCGGAGCCTTATGTGATGGTGTTATCTCGAGATAACACCATCACATAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007920.3-3691s21c1
Sequence:GTACCGGACTATCAGGTCTGCCATAAATCTCGAGATTTATGGCAGACCTGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-1233s21c1
Sequence:CCGGCCCGACGACTACACCAAATATCTCGAGATATTTGGTGTAGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007920.2-3287s1c1
Sequence:CCGGCGCAGGTGAATTTCTGAGTTTCTCGAGAAACTCAGAAATTCACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1233s1c1
Sequence:CCGGCCCGACGACTACACCAAATATCTCGAGATATTTGGTGTAGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007920.2-2371s1c1
Sequence:CCGGGCCGAAGATGATTTGAATGAACTCGAGTTCATTCAAATCATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1713s1c1
Sequence:CCGGCGGGAATTCTAAAGCTGCAAACTCGAGTTTGCAGCTTTAGAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1712s1c1
Sequence:CCGGCCGGGAATTCTAAAGCTGCAACTCGAGTTGCAGCTTTAGAATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007920
VALIDATED
ELF1 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 1 (ets domain transcription factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007920.3-703s21c1
Sequence:CCGGGTGTTTGAATTTGCAAGTAACCTCGAGGTTACTTGCAAATTCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-1912s21c1
Sequence:CCGGGTTCCAAGTATTAGGACTATACTCGAGTATAGTCCTAATACTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-2420s21c1
Sequence:GTACCGGAGCCTTATGTGATGGTGTTATCTCGAGATAACACCATCACATAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007920.3-3691s21c1
Sequence:GTACCGGACTATCAGGTCTGCCATAAATCTCGAGATTTATGGCAGACCTGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007920.3-1233s21c1
Sequence:CCGGCCCGACGACTACACCAAATATCTCGAGATATTTGGTGTAGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007920.2-3287s1c1
Sequence:CCGGCGCAGGTGAATTTCTGAGTTTCTCGAGAAACTCAGAAATTCACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1233s1c1
Sequence:CCGGCCCGACGACTACACCAAATATCTCGAGATATTTGGTGTAGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007920.2-2371s1c1
Sequence:CCGGGCCGAAGATGATTTGAATGAACTCGAGTTCATTCAAATCATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1713s1c1
Sequence:CCGGCGGGAATTCTAAAGCTGCAAACTCGAGTTTGCAGCTTTAGAATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007920.2-1712s1c1
Sequence:CCGGCCGGGAATTCTAAAGCTGCAACTCGAGTTGCAGCTTTAGAATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172373
VALIDATED
ELF1 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 1 (ets domain transcription factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-341s21c1
Sequence:CCGGATGTTCCTGGTGCTGATATTCCTCGAGGAATATCAGCACCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1076s21c1
Sequence:CCGGAGCGCTTGGTGTATCAGTTTACTCGAGTAAACTGATACACCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172373.2-2559s21c1
Sequence:CCGGTTTAGTTGACTGCACTATATACTCGAGTATATAGTGCAGTCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1608s21c1
Sequence:CCGGTACTGGATCTCAGAAGTTTATCTCGAGATAAACTTCTGAGATCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1024s21c1
Sequence:CCGGAGAGCACTCAGGTACTATTACCTCGAGGTAATAGTACCTGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172373.2-2891s1c1
Sequence:CCGGGCAGAGAAATAAGTGACCCAACTCGAGTTGGGTCACTTATTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_172373.2-1183s1c1
Sequence:CCGGGCCACTTCAAATAGGAATCAACTCGAGTTGATTCCTATTTGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-1877s1c1
Sequence:CCGGGCACTGTAATCACTTCAGTTACTCGAGTAACTGAAGTGATTACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-322s1c1
Sequence:CCGGCCTGCCGTAATTGTGGAACATCTCGAGATGTTCCACAATTACGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-1470s1c1
Sequence:CCGGCGTTCAGAGTATTAGGACTATCTCGAGATAGTCCTAATACTCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172373
VALIDATED
ELF1 MISSION shRNA shRNA Plasmid DNA
E74-like factor 1 (ets domain transcription factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-341s21c1
Sequence:CCGGATGTTCCTGGTGCTGATATTCCTCGAGGAATATCAGCACCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1076s21c1
Sequence:CCGGAGCGCTTGGTGTATCAGTTTACTCGAGTAAACTGATACACCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172373.2-2559s21c1
Sequence:CCGGTTTAGTTGACTGCACTATATACTCGAGTATATAGTGCAGTCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1608s21c1
Sequence:CCGGTACTGGATCTCAGAAGTTTATCTCGAGATAAACTTCTGAGATCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1024s21c1
Sequence:CCGGAGAGCACTCAGGTACTATTACCTCGAGGTAATAGTACCTGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172373.2-2891s1c1
Sequence:CCGGGCAGAGAAATAAGTGACCCAACTCGAGTTGGGTCACTTATTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_172373.2-1183s1c1
Sequence:CCGGGCCACTTCAAATAGGAATCAACTCGAGTTGATTCCTATTTGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-1877s1c1
Sequence:CCGGGCACTGTAATCACTTCAGTTACTCGAGTAACTGAAGTGATTACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-322s1c1
Sequence:CCGGCCTGCCGTAATTGTGGAACATCTCGAGATGTTCCACAATTACGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-1470s1c1
Sequence:CCGGCGTTCAGAGTATTAGGACTATCTCGAGATAGTCCTAATACTCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172373
VALIDATED
ELF1 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 1 (ets domain transcription factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-341s21c1
Sequence:CCGGATGTTCCTGGTGCTGATATTCCTCGAGGAATATCAGCACCAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1076s21c1
Sequence:CCGGAGCGCTTGGTGTATCAGTTTACTCGAGTAAACTGATACACCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172373.2-2559s21c1
Sequence:CCGGTTTAGTTGACTGCACTATATACTCGAGTATATAGTGCAGTCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1608s21c1
Sequence:CCGGTACTGGATCTCAGAAGTTTATCTCGAGATAAACTTCTGAGATCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172373.2-1024s21c1
Sequence:CCGGAGAGCACTCAGGTACTATTACCTCGAGGTAATAGTACCTGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172373.2-2891s1c1
Sequence:CCGGGCAGAGAAATAAGTGACCCAACTCGAGTTGGGTCACTTATTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_172373.2-1183s1c1
Sequence:CCGGGCCACTTCAAATAGGAATCAACTCGAGTTGATTCCTATTTGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-1877s1c1
Sequence:CCGGGCACTGTAATCACTTCAGTTACTCGAGTAACTGAAGTGATTACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-322s1c1
Sequence:CCGGCCTGCCGTAATTGTGGAACATCTCGAGATGTTCCACAATTACGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172373.2-1470s1c1
Sequence:CCGGCGTTCAGAGTATTAGGACTATCTCGAGATAGTCCTAATACTCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks