EMAIL THIS PAGE TO A FRIEND

ELF2

E74-like factor 2 (ets domain transcription factor)

163 Gene Product Result for
Synonyms: EU32 NERF NERF-1A NERF-1B NERF-1a,b NERF-2
UniProtKB ID: Q15723, Q15724, Q15725, Q6P1K5
Gene ID:
Mouse(69257) E74-like factor 2
Rat(361944) E74-like factor 2
naked mole-rat(101711206) E74-like factor 2 (ets domain transcription factor)
domestic guinea pig(100714702) E74-like factor 2 (ets domain transcription factor)
sheep(101117192) E74-like factor 2 (ets domain transcription factor)
chicken(422439) E74-like factor 2 (ets domain transcription factor)
cow(613439) E74-like factor 2 (ets domain transcription factor)
Horse(100063399) E74-like factor 2 (ets domain transcription factor)
domestic cat(101091937) E74-like factor 2 (ets domain transcription factor)
dog(476080) E74-like factor 2 (ets domain transcription factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006874 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006874 Rosetta Predictions human pricing
NM_201999 Rosetta Predictions human pricing
NM_001012181 Rosetta Predictions rat pricing
NM_001033909 Rosetta Predictions rat pricing
NM_023502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342515 predicted 1370
2 SASI_Hs02_00342516 predicted 1415
3 SASI_Hs01_00106014 predicted 1179
4 SASI_Hs02_00342517 predicted 1840
5 SASI_Hs01_00106015 predicted 733
6 SASI_Hs02_00342518 predicted 1956
7 SASI_Hs02_00342519 predicted 1690
8 SASI_Hs02_00342520 predicted 1611
9 SASI_Hs02_00342521 predicted 1530
10 SASI_Hs01_00106018 predicted 1623
11 SASI_Hs01_00106012 predicted 956
12 SASI_Hs01_00106013 predicted 844
13 SASI_Hs01_00106016 predicted 892
14 SASI_Hs01_00106017 predicted 833
15 SASI_Hs01_00106019 predicted 748
16 SASI_Hs01_00106020 predicted 749
17 SASI_Hs01_00106021 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373172 predicted 1413
2 SASI_Hs02_00373173 predicted 1468
3 SASI_Hs01_00224375 predicted 1225
4 SASI_Hs02_00373174 predicted 1887
5 SASI_Hs01_00224376 predicted 789
6 SASI_Hs02_00373175 predicted 1996
7 SASI_Hs02_00373176 predicted 1731
8 SASI_Hs02_00373177 predicted 1656
9 SASI_Hs02_00373178 predicted 1580
10 SASI_Hs01_00224379 predicted 1675
11 SASI_Hs01_00224373 predicted 1011
12 SASI_Hs01_00224374 predicted 895
13 SASI_Hs01_00224377 predicted 943
14 SASI_Hs01_00224378 predicted 873
15 SASI_Hs01_00224380 predicted 789
16 SASI_Hs01_00224381 predicted 792
17 SASI_Hs01_00224382 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200386 predicted 2127
2 SASI_Rn01_00039253 predicted 2048
3 SASI_Rn01_00039254 predicted 1173
4 SASI_Rn01_00039255 predicted 1791
5 SASI_Rn01_00039256 predicted 2416
6 SASI_Rn01_00039257 predicted 1966
7 SASI_Rn01_00039258 predicted 2073
8 SASI_Rn01_00039259 predicted 2230
9 SASI_Rn01_00039260 predicted 2375
10 SASI_Rn01_00039261 predicted 1413
11 SASI_Rn01_00039262 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203822 predicted 1809
2 SASI_Rn01_00038539 predicted 1729
3 SASI_Rn01_00038540 predicted 850
4 SASI_Rn01_00038541 predicted 1467
5 SASI_Rn01_00038542 predicted 2092
6 SASI_Rn01_00038543 predicted 1652
7 SASI_Rn01_00038544 predicted 1755
8 SASI_Rn01_00038545 predicted 1912
9 SASI_Rn01_00038546 predicted 2051
10 SASI_Rn01_00038547 predicted 1090
11 SASI_Rn01_00038548 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109814 predicted 2071
2 SASI_Mm01_00109815 predicted 552
3 SASI_Mm01_00109816 predicted 361
4 SASI_Mm02_00327147 predicted 1692
5 SASI_Mm01_00109817 predicted 815
6 SASI_Mm02_00327148 predicted 1776
7 SASI_Mm01_00109818 predicted 321
8 SASI_Mm01_00109819 predicted 449
9 SASI_Mm01_00109820 predicted 498
10 SASI_Mm02_00327149 predicted 433
11 SASI_Mm01_00109821 predicted 468
12 SASI_Mm01_00109822 predicted 1885
13 SASI_Mm01_00109823 predicted 902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023502
VALIDATED
ELF2 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 2 (ets domain transcription factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-1930s1c1
Sequence:CCGGGCCCTTCCTGTGACTATGAAACTCGAGTTTCATAGTCACAGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-1141s1c1
Sequence:CCGGGCTGATGACAAGTCTTTAGAACTCGAGTTCTAAAGACTTGTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023502.1-2328s1c1
Sequence:CCGGCGTCATTGTTACAAAGAGCATCTCGAGATGCTCTTTGTAACAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-993s1c1
Sequence:CCGGGCGAGCGTTAAGATATTACTACTCGAGTAGTAATATCTTAACGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-954s1c1
Sequence:CCGGGCATAAGAACAAACCAGATATCTCGAGATATCTGGTTTGTTCTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-363s21c1
Sequence:CCGGCTATGACGACGAGACTTATATCTCGAGATATAAGTCTCGTCGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-1445s21c1
Sequence:CCGGGCACAGGCTCGCCGTTAATAACTCGAGTTATTAACGGCGAGCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023502.1-2328s21c1
Sequence:CCGGCGTCATTGTTACAAAGAGCATCTCGAGATGCTCTTTGTAACAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-863s21c1
Sequence:CCGGATACTTGTCCCAGGTATATTACTCGAGTAATATACCTGGGACAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-1776s21c1
Sequence:CCGGAGTTATCAGTGCGCTCCTAAACTCGAGTTTAGGAGCGCACTGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023502
VALIDATED
ELF2 MISSION shRNA shRNA Plasmid DNA
E74-like factor 2 (ets domain transcription factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-1930s1c1
Sequence:CCGGGCCCTTCCTGTGACTATGAAACTCGAGTTTCATAGTCACAGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-1141s1c1
Sequence:CCGGGCTGATGACAAGTCTTTAGAACTCGAGTTCTAAAGACTTGTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023502.1-2328s1c1
Sequence:CCGGCGTCATTGTTACAAAGAGCATCTCGAGATGCTCTTTGTAACAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-993s1c1
Sequence:CCGGGCGAGCGTTAAGATATTACTACTCGAGTAGTAATATCTTAACGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-954s1c1
Sequence:CCGGGCATAAGAACAAACCAGATATCTCGAGATATCTGGTTTGTTCTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-363s21c1
Sequence:CCGGCTATGACGACGAGACTTATATCTCGAGATATAAGTCTCGTCGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-1445s21c1
Sequence:CCGGGCACAGGCTCGCCGTTAATAACTCGAGTTATTAACGGCGAGCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023502.1-2328s21c1
Sequence:CCGGCGTCATTGTTACAAAGAGCATCTCGAGATGCTCTTTGTAACAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-863s21c1
Sequence:CCGGATACTTGTCCCAGGTATATTACTCGAGTAATATACCTGGGACAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-1776s21c1
Sequence:CCGGAGTTATCAGTGCGCTCCTAAACTCGAGTTTAGGAGCGCACTGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023502
VALIDATED
ELF2 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 2 (ets domain transcription factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-1930s1c1
Sequence:CCGGGCCCTTCCTGTGACTATGAAACTCGAGTTTCATAGTCACAGGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-1141s1c1
Sequence:CCGGGCTGATGACAAGTCTTTAGAACTCGAGTTCTAAAGACTTGTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023502.1-2328s1c1
Sequence:CCGGCGTCATTGTTACAAAGAGCATCTCGAGATGCTCTTTGTAACAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-993s1c1
Sequence:CCGGGCGAGCGTTAAGATATTACTACTCGAGTAGTAATATCTTAACGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023502.1-954s1c1
Sequence:CCGGGCATAAGAACAAACCAGATATCTCGAGATATCTGGTTTGTTCTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-363s21c1
Sequence:CCGGCTATGACGACGAGACTTATATCTCGAGATATAAGTCTCGTCGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-1445s21c1
Sequence:CCGGGCACAGGCTCGCCGTTAATAACTCGAGTTATTAACGGCGAGCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023502.1-2328s21c1
Sequence:CCGGCGTCATTGTTACAAAGAGCATCTCGAGATGCTCTTTGTAACAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-863s21c1
Sequence:CCGGATACTTGTCCCAGGTATATTACTCGAGTAATATACCTGGGACAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023502.1-1776s21c1
Sequence:CCGGAGTTATCAGTGCGCTCCTAAACTCGAGTTTAGGAGCGCACTGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006874
VALIDATED
ELF2 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 2 (ets domain transcription factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006874.2-1963s1c1
Sequence:CCGGGCAAGGGAAGTCATCAAGAAACTCGAGTTTCTTGATGACTTCCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006874.2-922s1c1
Sequence:CCGGGCTTTGAGATACTACTACCAACTCGAGTTGGTAGTAGTATCTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006874.2-655s1c1
Sequence:CCGGCGTAAACCAAAGACCCAGCAACTCGAGTTGCTGGGTCTTTGGTTTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006874.2-1634s1c1
Sequence:CCGGGTACACCTGTAATGAGACTATCTCGAGATAGTCTCATTACAGGTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006874.2-1305s1c1
Sequence:CCGGACCTGTTGTAATGACATCATTCTCGAGAATGATGTCATTACAACAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-788s21c1
Sequence:CCGGATACTTGTCCCAGGTATATTACTCGAGTAATATACCTGGGACAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-527s21c1
Sequence:CCGGCTATGAGGCCAGATGTCATTACTCGAGTAATGACATCTGGCCTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-1364s21c1
Sequence:CCGGATGCAGGTGCACCATTAATAACTCGAGTTATTAATGGTGCACCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-693s21c1
Sequence:CCGGGTCTCCTGAGTTAGGTATAAACTCGAGTTTATACCTAACTCAGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006874.2-2214s21c1
Sequence:CCGGCATTCTGTAAGAGGTTATATACTCGAGTATATAACCTCTTACAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006874
VALIDATED
ELF2 MISSION shRNA shRNA Plasmid DNA
E74-like factor 2 (ets domain transcription factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006874.2-1963s1c1
Sequence:CCGGGCAAGGGAAGTCATCAAGAAACTCGAGTTTCTTGATGACTTCCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006874.2-922s1c1
Sequence:CCGGGCTTTGAGATACTACTACCAACTCGAGTTGGTAGTAGTATCTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006874.2-655s1c1
Sequence:CCGGCGTAAACCAAAGACCCAGCAACTCGAGTTGCTGGGTCTTTGGTTTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006874.2-1634s1c1
Sequence:CCGGGTACACCTGTAATGAGACTATCTCGAGATAGTCTCATTACAGGTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006874.2-1305s1c1
Sequence:CCGGACCTGTTGTAATGACATCATTCTCGAGAATGATGTCATTACAACAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-788s21c1
Sequence:CCGGATACTTGTCCCAGGTATATTACTCGAGTAATATACCTGGGACAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-527s21c1
Sequence:CCGGCTATGAGGCCAGATGTCATTACTCGAGTAATGACATCTGGCCTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-1364s21c1
Sequence:CCGGATGCAGGTGCACCATTAATAACTCGAGTTATTAATGGTGCACCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-693s21c1
Sequence:CCGGGTCTCCTGAGTTAGGTATAAACTCGAGTTTATACCTAACTCAGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006874.2-2214s21c1
Sequence:CCGGCATTCTGTAAGAGGTTATATACTCGAGTATATAACCTCTTACAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006874
VALIDATED
ELF2 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 2 (ets domain transcription factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006874.2-1963s1c1
Sequence:CCGGGCAAGGGAAGTCATCAAGAAACTCGAGTTTCTTGATGACTTCCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006874.2-922s1c1
Sequence:CCGGGCTTTGAGATACTACTACCAACTCGAGTTGGTAGTAGTATCTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006874.2-655s1c1
Sequence:CCGGCGTAAACCAAAGACCCAGCAACTCGAGTTGCTGGGTCTTTGGTTTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006874.2-1634s1c1
Sequence:CCGGGTACACCTGTAATGAGACTATCTCGAGATAGTCTCATTACAGGTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006874.2-1305s1c1
Sequence:CCGGACCTGTTGTAATGACATCATTCTCGAGAATGATGTCATTACAACAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-788s21c1
Sequence:CCGGATACTTGTCCCAGGTATATTACTCGAGTAATATACCTGGGACAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-527s21c1
Sequence:CCGGCTATGAGGCCAGATGTCATTACTCGAGTAATGACATCTGGCCTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-1364s21c1
Sequence:CCGGATGCAGGTGCACCATTAATAACTCGAGTTATTAATGGTGCACCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006874.2-693s21c1
Sequence:CCGGGTCTCCTGAGTTAGGTATAAACTCGAGTTTATACCTAACTCAGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006874.2-2214s21c1
Sequence:CCGGCATTCTGTAAGAGGTTATATACTCGAGTATATAACCTCTTACAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)