EMAIL THIS PAGE TO A FRIEND

ELF3

E74-like factor 3 (ets domain transcription factor, epithelial-specific )

72 Gene Product Result for
Synonyms: EPR-1 ERT ESE-1 ESX
Gene ID:
Mouse(13710) E74-like factor 3
Rat(304815) E74-like factor 3
Zebrafish(560869) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
chicken(421177) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
dog(490235) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
domestic cat(101097614) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Thale Cress(817134) protein EARLY FLOWERING 3
cow(508503) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
sheep(101104676) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
domestic guinea pig(100724220) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
naked mole-rat(101716801) E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31639 Anti-ELF3 (AB1) antibody produced in rabbit affinity isolated antibody horse, canine, rabbit, pig, bovine, human
western blot pricing
AV40156 Anti-ELF3 (AB2) antibody produced in rabbit affinity isolated antibody mouse, canine, human, horse, rabbit, rat
western blot pricing
AV36846 Anti-ELF3 (AB3) antibody produced in rabbit affinity isolated antibody rat, mouse
immunohistochemistry, western blot pricing
SAB1412207 ANTI-ELF3 antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412338 ANTI-ELF3 antibody produced in mouse clone 1F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412339 ANTI-ELF3 antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412340 ANTI-ELF3 antibody produced in mouse clone 3B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA003316 Anti-ELF3 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV32247 Anti-ELF3 antibody produced in rabbit IgG fraction of antiserum human, canine, mouse, horse, guinea pig, rat, bovine, rabbit
western blot pricing
HPA003479 Anti-ELF3 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2105250 Anti-ELF3 antibody produced in rabbit affinity isolated antibody guinea pig, mouse
western blot pricing
SAB2500348 Anti-ELF3/ERT/ ESX antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
WH0001999M2 Monoclonal Anti-ELF3 antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403767 Monoclonal Anti-ELF3, (C-terminal) antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062881 MISSION® esiRNA esiRNA human ELF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114309 Rosetta Predictions human pricing
NM_004433 Rosetta Predictions human pricing
NM_001024768 Rosetta Predictions rat pricing
NM_007921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326494 predicted 1400
2 SASI_Hs02_00326495 predicted 1871
3 SASI_Hs02_00326496 predicted 516
4 SASI_Hs02_00326497 predicted 538
5 SASI_Hs02_00326498 predicted 1372
6 SASI_Hs02_00326499 predicted 1843
7 SASI_Hs02_00326500 predicted 1274
8 SASI_Hs02_00326501 predicted 885
9 SASI_Hs02_00326502 predicted 1350
10 SASI_Hs02_00326503 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107843 predicted 1286
2 SASI_Hs02_00337602 predicted 1762
3 SASI_Hs01_00107845 predicted 405
4 SASI_Hs01_00107846 predicted 425
5 SASI_Hs01_00107848 predicted 1260
6 SASI_Hs02_00337603 predicted 1738
7 SASI_Hs01_00107850 predicted 1164
8 SASI_Hs02_00337604 predicted 773
9 SASI_Hs01_00107851 predicted 1240
10 SASI_Hs02_00337605 predicted 1722
11 SASI_Hs01_00107844 predicted 3204
12 SASI_Hs01_00107847 predicted 3221
13 SASI_Hs01_00107849 predicted 3573
14 SASI_Hs01_00107852 predicted 4568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078924 predicted 911
2 SASI_Rn01_00078925 predicted 827
3 SASI_Rn01_00078926 predicted 550
4 SASI_Rn01_00078927 predicted 406
5 SASI_Rn01_00078928 predicted 308
6 SASI_Rn02_00202651 predicted 560
7 SASI_Rn01_00078929 predicted 1029
8 SASI_Rn01_00078930 predicted 975
9 SASI_Rn01_00078931 predicted 859
10 SASI_Rn01_00078932 predicted 920
11 SASI_Rn01_00078933 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312747 predicted 305
2 SASI_Mm01_00029730 predicted 1193
3 SASI_Mm02_00312748 predicted 781
4 SASI_Mm01_00029731 predicted 909
5 SASI_Mm01_00029732 predicted 994
6 SASI_Mm01_00029735 predicted 1085
7 SASI_Mm01_00029736 predicted 1245
8 SASI_Mm01_00029737 predicted 760
9 SASI_Mm01_00029738 predicted 525
10 SASI_Mm01_00029739 predicted 626
11 SASI_Mm01_00029733 predicted 849
12 SASI_Mm01_00029734 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004433
ELF3 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004433.4-1767s21c1
Sequence:CCGGAGATGTACATAGAGATCTATTCTCGAGAATAGATCTCTATGTACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004433.4-1263s21c1
Sequence:CCGGGAACTGAGGGTTGGAACTATACTCGAGTATAGTTCCAACCCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004433.3-4773s1c1
Sequence:CCGGCTCCCTAATTTATGTGCTATACTCGAGTATAGCACATAAATTAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3226s1c1
Sequence:CCGGCAACTACTTCAGTGCGATGTACTCGAGTACATCGCACTGAAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3582s1c1
Sequence:CCGGGCTCTTCTGATGAGCTCAGTTCTCGAGAACTGAGCTCATCAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3940s1c1
Sequence:CCGGCCGAAAGCTGAGCAAAGAGTACTCGAGTACTCTTTGCTCAGCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-4184s1c1
Sequence:CCGGGCCATGAGGTACTACTACAAACTCGAGTTTGTAGTAGTACCTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004433
ELF3 MISSION shRNA shRNA Plasmid DNA
E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004433.4-1767s21c1
Sequence:CCGGAGATGTACATAGAGATCTATTCTCGAGAATAGATCTCTATGTACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004433.4-1263s21c1
Sequence:CCGGGAACTGAGGGTTGGAACTATACTCGAGTATAGTTCCAACCCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004433.3-4773s1c1
Sequence:CCGGCTCCCTAATTTATGTGCTATACTCGAGTATAGCACATAAATTAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3226s1c1
Sequence:CCGGCAACTACTTCAGTGCGATGTACTCGAGTACATCGCACTGAAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3582s1c1
Sequence:CCGGGCTCTTCTGATGAGCTCAGTTCTCGAGAACTGAGCTCATCAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3940s1c1
Sequence:CCGGCCGAAAGCTGAGCAAAGAGTACTCGAGTACTCTTTGCTCAGCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-4184s1c1
Sequence:CCGGGCCATGAGGTACTACTACAAACTCGAGTTTGTAGTAGTACCTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004433
ELF3 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004433.4-1767s21c1
Sequence:CCGGAGATGTACATAGAGATCTATTCTCGAGAATAGATCTCTATGTACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004433.4-1263s21c1
Sequence:CCGGGAACTGAGGGTTGGAACTATACTCGAGTATAGTTCCAACCCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004433.3-4773s1c1
Sequence:CCGGCTCCCTAATTTATGTGCTATACTCGAGTATAGCACATAAATTAGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3226s1c1
Sequence:CCGGCAACTACTTCAGTGCGATGTACTCGAGTACATCGCACTGAAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3582s1c1
Sequence:CCGGGCTCTTCTGATGAGCTCAGTTCTCGAGAACTGAGCTCATCAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-3940s1c1
Sequence:CCGGCCGAAAGCTGAGCAAAGAGTACTCGAGTACTCTTTGCTCAGCTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004433.3-4184s1c1
Sequence:CCGGGCCATGAGGTACTACTACAAACTCGAGTTTGTAGTAGTACCTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007921
ELF3 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-820s21c1
Sequence:CCGGGATGGCTTTCCTGACTATAAGCTCGAGCTTATAGTCAGGAAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-1118s21c1
Sequence:CCGGTGAGCCGAGCCATGAGGTATTCTCGAGAATACCTCATGGCTCGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-1228s21c1
Sequence:CCGGGTTGGAGAGAGTCGGAATTAACTCGAGTTAATTCCGACTCTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007921.3-1683s21c1
Sequence:CCGGGGTCGGATCATCCCTAATTTACTCGAGTAAATTAGGGATGATCCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-963s21c1
Sequence:CCGGGTTTATCCGAGACATCCTAATCTCGAGATTAGGATGTCTCGGATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-1088s1c1
Sequence:CCGGCCGAGCCATGAGGTATTACTACTCGAGTAGTAATACCTCATGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-212s1c1
Sequence:CCGGCTTGGTGTTGACCCTGAACAACTCGAGTTGTTCAGGGTCAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-784s1c1
Sequence:CCGGGAGATGGCTTTCCTGACTATACTCGAGTATAGTCAGGAAAGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-1148s1c1
Sequence:CCGGCGTCTACAAGTTTGGCAAGAACTCGAGTTCTTGCCAAACTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-329s1c1
Sequence:CCGGCCAAGTGGAGAAGAACAAGTACTCGAGTACTTGTTCTTCTCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007921
ELF3 MISSION shRNA shRNA Plasmid DNA
E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-820s21c1
Sequence:CCGGGATGGCTTTCCTGACTATAAGCTCGAGCTTATAGTCAGGAAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-1118s21c1
Sequence:CCGGTGAGCCGAGCCATGAGGTATTCTCGAGAATACCTCATGGCTCGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-1228s21c1
Sequence:CCGGGTTGGAGAGAGTCGGAATTAACTCGAGTTAATTCCGACTCTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007921.3-1683s21c1
Sequence:CCGGGGTCGGATCATCCCTAATTTACTCGAGTAAATTAGGGATGATCCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-963s21c1
Sequence:CCGGGTTTATCCGAGACATCCTAATCTCGAGATTAGGATGTCTCGGATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-1088s1c1
Sequence:CCGGCCGAGCCATGAGGTATTACTACTCGAGTAGTAATACCTCATGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-212s1c1
Sequence:CCGGCTTGGTGTTGACCCTGAACAACTCGAGTTGTTCAGGGTCAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-784s1c1
Sequence:CCGGGAGATGGCTTTCCTGACTATACTCGAGTATAGTCAGGAAAGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-1148s1c1
Sequence:CCGGCGTCTACAAGTTTGGCAAGAACTCGAGTTCTTGCCAAACTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-329s1c1
Sequence:CCGGCCAAGTGGAGAAGAACAAGTACTCGAGTACTTGTTCTTCTCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007921
ELF3 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-820s21c1
Sequence:CCGGGATGGCTTTCCTGACTATAAGCTCGAGCTTATAGTCAGGAAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-1118s21c1
Sequence:CCGGTGAGCCGAGCCATGAGGTATTCTCGAGAATACCTCATGGCTCGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-1228s21c1
Sequence:CCGGGTTGGAGAGAGTCGGAATTAACTCGAGTTAATTCCGACTCTCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007921.3-1683s21c1
Sequence:CCGGGGTCGGATCATCCCTAATTTACTCGAGTAAATTAGGGATGATCCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007921.3-963s21c1
Sequence:CCGGGTTTATCCGAGACATCCTAATCTCGAGATTAGGATGTCTCGGATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-1088s1c1
Sequence:CCGGCCGAGCCATGAGGTATTACTACTCGAGTAGTAATACCTCATGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-212s1c1
Sequence:CCGGCTTGGTGTTGACCCTGAACAACTCGAGTTGTTCAGGGTCAACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-784s1c1
Sequence:CCGGGAGATGGCTTTCCTGACTATACTCGAGTATAGTCAGGAAAGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-1148s1c1
Sequence:CCGGCGTCTACAAGTTTGGCAAGAACTCGAGTTCTTGCCAAACTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007921.1-329s1c1
Sequence:CCGGCCAAGTGGAGAAGAACAAGTACTCGAGTACTTGTTCTTCTCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks