EMAIL THIS PAGE TO A FRIEND

ELF4

E74-like factor 4 (ets domain transcription factor)

160 Gene Product Result for
Synonyms: ELFR MEF
UniProtKB ID: Q99607, D3DTG1, O60435
Gene ID:
Human(2000) Summary: The protein encoded by this gene is a transcriptional activator that binds and activates the promoters of the CSF2, IL3, IL8, and PRF1 genes. The encoded protein is involved in natural killer cell development and function, innate immunity, and induction of cell cycle arrest in naive CD8+ cells. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(56501) E74-like factor 4 (ets domain transcription factor)
Rat(302811) E74-like factor 4 (ets domain transcription factor)
naked mole-rat(101697787) E74-like factor 4 (ets domain transcription factor)
domestic guinea pig(100731245) E74-like factor 4 (ets domain transcription factor)
sheep(101121321) E74-like factor 4 (ets domain transcription factor)
Domestic Rabbit(100347529) E74-like factor 4 (ets domain transcription factor)
Thale Cress(818596) hypothetical protein
dog(492129) E74-like factor 4 (ets domain transcription factor)
cow(504514) E74-like factor 4 (ets domain transcription factor)
Horse(100054591) E74-like factor 4 (ets domain transcription factor)
domestic cat(101081614) E74-like factor 4 (ets domain transcription factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127197 Rosetta Predictions human pricing
NM_001421 Rosetta Predictions human pricing
XM_001059821 Rosetta Predictions rat pricing
XM_229125 Rosetta Predictions rat pricing
NM_019680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328697 predicted 612
2 SASI_Hs02_00328698 predicted 1330
3 SASI_Hs02_00328699 predicted 1076
4 SASI_Hs02_00328700 predicted 306
5 SASI_Hs02_00328701 predicted 1115
6 SASI_Hs02_00328702 predicted 344
7 SASI_Hs02_00328703 predicted 636
8 SASI_Hs02_00328704 predicted 1734
9 SASI_Hs02_00328705 predicted 398
10 SASI_Hs02_00328706 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189458 predicted 689
2 SASI_Hs01_00189459 predicted 1412
3 SASI_Hs01_00189460 predicted 1153
4 SASI_Hs01_00189461 predicted 388
5 SASI_Hs01_00189462 predicted 1196
6 SASI_Hs01_00189463 predicted 426
7 SASI_Hs01_00189464 predicted 717
8 SASI_Hs01_00189465 predicted 1815
9 SASI_Hs01_00189466 predicted 477
10 SASI_Hs01_00189467 predicted 2452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294449 predicted 304
2 SASI_Rn02_00294450 predicted 635
3 SASI_Rn02_00294451 predicted 1061
4 SASI_Rn02_00294452 predicted 513
5 SASI_Rn02_00294453 predicted 2237
6 SASI_Rn02_00294454 predicted 1760
7 SASI_Rn02_00294455 predicted 1826
8 SASI_Rn02_00294456 predicted 1392
9 SASI_Rn02_00294457 predicted 2010
10 SASI_Rn02_00294458 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385800 predicted 284
2 SASI_Rn02_00385801 predicted 301
3 SASI_Rn02_00385802 predicted 2086
4 SASI_Rn02_00385803 predicted 2236
5 SASI_Rn02_00385804 predicted 2315
6 SASI_Rn02_00385805 predicted 2368
7 SASI_Rn02_00385806 predicted 2424
8 SASI_Rn02_00385807 predicted 2018
9 SASI_Rn02_00385808 predicted 2354
10 SASI_Rn02_00385809 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192082 predicted 1518
2 SASI_Mm01_00192083 predicted 483
3 SASI_Mm01_00192084 predicted 244
4 SASI_Mm01_00192085 predicted 449
5 SASI_Mm01_00192086 predicted 222
6 SASI_Mm02_00324757 predicted 2161
7 SASI_Mm01_00192088 predicted 1470
8 SASI_Mm01_00192089 predicted 776
9 SASI_Mm01_00192090 predicted 1752
10 SASI_Mm01_00192091 predicted 1964
11 SASI_Mm01_00192087 predicted 1773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019680
ELF4 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 4 (ets domain transcription factor)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-1005s1c1
Sequence:CCGGGCCCTGAGATATTATTATCAACTCGAGTTGATAATAATATCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-324s1c1
Sequence:CCGGCCCTATCCTGAATTAGTGCATCTCGAGATGCACTAATTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-784s1c1
Sequence:CCGGGCATGCCTATACGGAAGAAATCTCGAGATTTCTTCCGTATAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-1515s1c1
Sequence:CCGGGCTCCAACTCAACTCGTTCTTCTCGAGAAGAACGAGTTGAGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-463s1c1
Sequence:CCGGCCACCTCAAATAACGTGTCATCTCGAGATGACACGTTATTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-430s21c1
Sequence:CCGGGGTCCACAATGGCATCATAAGCTCGAGCTTATGATGCCATTGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-538s21c1
Sequence:CCGGGTCATCCACTGAAGTCCTATTCTCGAGAATAGGACTTCAGTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-1058s21c1
Sequence:CCGGGGGCGAGCCCTGAGATATTATCTCGAGATAATATCTCAGGGCTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019680
ELF4 MISSION shRNA shRNA Plasmid DNA
E74-like factor 4 (ets domain transcription factor)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-1005s1c1
Sequence:CCGGGCCCTGAGATATTATTATCAACTCGAGTTGATAATAATATCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-324s1c1
Sequence:CCGGCCCTATCCTGAATTAGTGCATCTCGAGATGCACTAATTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-784s1c1
Sequence:CCGGGCATGCCTATACGGAAGAAATCTCGAGATTTCTTCCGTATAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-1515s1c1
Sequence:CCGGGCTCCAACTCAACTCGTTCTTCTCGAGAAGAACGAGTTGAGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-463s1c1
Sequence:CCGGCCACCTCAAATAACGTGTCATCTCGAGATGACACGTTATTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-430s21c1
Sequence:CCGGGGTCCACAATGGCATCATAAGCTCGAGCTTATGATGCCATTGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-538s21c1
Sequence:CCGGGTCATCCACTGAAGTCCTATTCTCGAGAATAGGACTTCAGTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-1058s21c1
Sequence:CCGGGGGCGAGCCCTGAGATATTATCTCGAGATAATATCTCAGGGCTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019680
ELF4 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 4 (ets domain transcription factor)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-1005s1c1
Sequence:CCGGGCCCTGAGATATTATTATCAACTCGAGTTGATAATAATATCTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-324s1c1
Sequence:CCGGCCCTATCCTGAATTAGTGCATCTCGAGATGCACTAATTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-784s1c1
Sequence:CCGGGCATGCCTATACGGAAGAAATCTCGAGATTTCTTCCGTATAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-1515s1c1
Sequence:CCGGGCTCCAACTCAACTCGTTCTTCTCGAGAAGAACGAGTTGAGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019680.1-463s1c1
Sequence:CCGGCCACCTCAAATAACGTGTCATCTCGAGATGACACGTTATTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-430s21c1
Sequence:CCGGGGTCCACAATGGCATCATAAGCTCGAGCTTATGATGCCATTGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-538s21c1
Sequence:CCGGGTCATCCACTGAAGTCCTATTCTCGAGAATAGGACTTCAGTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019680.2-1058s21c1
Sequence:CCGGGGGCGAGCCCTGAGATATTATCTCGAGATAATATCTCAGGGCTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001421
VALIDATED
ELF4 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 4 (ets domain transcription factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001421.1-3879s1c1
Sequence:CCGGCCACGGAAACAACTCTAATATCTCGAGATATTAGAGTTGTTTCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-664s1c1
Sequence:CCGGCGCGGAAGTCTTACTCAATATCTCGAGATATTGAGTAAGACTTCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001421.1-508s1c1
Sequence:CCGGCCCTGATTTACTGCATCTGTACTCGAGTACAGATGCAGTAAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-1732s1c1
Sequence:CCGGCTCTACTTTCAAGGACACCTTCTCGAGAAGGTGTCCTTGAAAGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-1184s1c1
Sequence:CCGGGCACTAAGATACTACTACCAACTCGAGTTGGTAGTAGTATCTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001421.3-2465s21c1
Sequence:CCGGCATTTCAGTGGGATGTCAATACTCGAGTATTGACATCCCACTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-721s21c1
Sequence:CCGGGATCTTCAGTACCTCCGAAATCTCGAGATTTCGGAGGTACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001421.3-2739s21c1
Sequence:CCGGAGGGAATTTACTACCCTATATCTCGAGATATAGGGTAGTAAATTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-1236s21c1
Sequence:CCGGAGAGGCTGGTGTACCAGTTTACTCGAGTAAACTGGTACACCAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-2335s21c1
Sequence:CCGGCAACCCTACTTCCCTCATTAACTCGAGTTAATGAGGGAAGTAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001421
VALIDATED
ELF4 MISSION shRNA shRNA Plasmid DNA
E74-like factor 4 (ets domain transcription factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001421.1-3879s1c1
Sequence:CCGGCCACGGAAACAACTCTAATATCTCGAGATATTAGAGTTGTTTCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-664s1c1
Sequence:CCGGCGCGGAAGTCTTACTCAATATCTCGAGATATTGAGTAAGACTTCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001421.1-508s1c1
Sequence:CCGGCCCTGATTTACTGCATCTGTACTCGAGTACAGATGCAGTAAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-1732s1c1
Sequence:CCGGCTCTACTTTCAAGGACACCTTCTCGAGAAGGTGTCCTTGAAAGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-1184s1c1
Sequence:CCGGGCACTAAGATACTACTACCAACTCGAGTTGGTAGTAGTATCTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001421.3-2465s21c1
Sequence:CCGGCATTTCAGTGGGATGTCAATACTCGAGTATTGACATCCCACTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-721s21c1
Sequence:CCGGGATCTTCAGTACCTCCGAAATCTCGAGATTTCGGAGGTACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001421.3-2739s21c1
Sequence:CCGGAGGGAATTTACTACCCTATATCTCGAGATATAGGGTAGTAAATTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-1236s21c1
Sequence:CCGGAGAGGCTGGTGTACCAGTTTACTCGAGTAAACTGGTACACCAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-2335s21c1
Sequence:CCGGCAACCCTACTTCCCTCATTAACTCGAGTTAATGAGGGAAGTAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001421
VALIDATED
ELF4 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 4 (ets domain transcription factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001421.1-3879s1c1
Sequence:CCGGCCACGGAAACAACTCTAATATCTCGAGATATTAGAGTTGTTTCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-664s1c1
Sequence:CCGGCGCGGAAGTCTTACTCAATATCTCGAGATATTGAGTAAGACTTCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001421.1-508s1c1
Sequence:CCGGCCCTGATTTACTGCATCTGTACTCGAGTACAGATGCAGTAAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-1732s1c1
Sequence:CCGGCTCTACTTTCAAGGACACCTTCTCGAGAAGGTGTCCTTGAAAGTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001421.1-1184s1c1
Sequence:CCGGGCACTAAGATACTACTACCAACTCGAGTTGGTAGTAGTATCTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001421.3-2465s21c1
Sequence:CCGGCATTTCAGTGGGATGTCAATACTCGAGTATTGACATCCCACTGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-721s21c1
Sequence:CCGGGATCTTCAGTACCTCCGAAATCTCGAGATTTCGGAGGTACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001421.3-2739s21c1
Sequence:CCGGAGGGAATTTACTACCCTATATCTCGAGATATAGGGTAGTAAATTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-1236s21c1
Sequence:CCGGAGAGGCTGGTGTACCAGTTTACTCGAGTAAACTGGTACACCAGCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001421.3-2335s21c1
Sequence:CCGGCAACCCTACTTCCCTCATTAACTCGAGTTAATGAGGGAAGTAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks