EMAIL THIS PAGE TO A FRIEND

ELF5

E74-like factor 5 (ets domain transcription factor)

Synonyms: ESE2
UniProtKB ID: Q9UKW6, A8K452, O95175, Q8N2K9, Q96QY3, Q9UKW5
Gene ID:
Human(2001) Summary: The protein encoded by this gene is a member of an epithelium-specific subclass of the Ets transcritpion factor family. In addition to its role in regulating the later stages of terminal differentiation of keratinocytes, it appears to regulate a number of epithelium-specific genes found in tissues containing glandular epithelium such as salivary gland and prostate. It has very low affinity to DNA due to its negative regulatory domain at the amino terminus. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Mouse(13711) E74-like factor 5
Rat(366142) E74-like factor 5
chicken(428859) E74-like factor 5 (ets domain transcription factor)
domestic cat(101094131) E74-like factor 5 (ets domain transcription factor)
cow(539420) E74-like factor 5 (ets domain transcription factor)
dog(608908) E74-like factor 5 (ets domain transcription factor)
sheep(101104338) E74-like factor 5 (ets domain transcription factor)
domestic guinea pig(100725981) E74-like factor 5 (ets domain transcription factor)
naked mole-rat(101706269) E74-like factor 5 (ets domain transcription factor)
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001422 Rosetta Predictions human pricing
NM_198381 Rosetta Predictions human pricing
NM_001108956 Rosetta Predictions rat pricing
NM_010125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021834 predicted 486
2 SASI_Hs01_00021835 predicted 658
3 SASI_Hs01_00021836 predicted 420
4 SASI_Hs01_00021837 predicted 518
5 SASI_Hs01_00021838 predicted 497
6 SASI_Hs01_00021839 predicted 320
7 SASI_Hs01_00021840 predicted 310
8 SASI_Hs01_00021842 predicted 584
9 SASI_Hs02_00331824 predicted 560
10 SASI_Hs02_00331825 predicted 558
11 SASI_Hs01_00021841 predicted 668
12 SASI_Hs01_00021843 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115098 predicted 636
2 SASI_Hs01_00115099 predicted 808
3 SASI_Hs01_00115100 predicted 568
4 SASI_Hs01_00115101 predicted 664
5 SASI_Hs01_00115102 predicted 647
6 SASI_Hs01_00115103 predicted 470
7 SASI_Hs01_00115104 predicted 458
8 SASI_Hs01_00115106 predicted 737
9 SASI_Hs02_00371894 predicted 711
10 SASI_Hs02_00371895 predicted 703
11 SASI_Hs01_00115105 predicted 815
12 SASI_Hs01_00115107 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243744 predicted 1303
2 SASI_Rn02_00243745 predicted 492
3 SASI_Rn02_00243746 predicted 1296
4 SASI_Rn02_00243747 predicted 1323
5 SASI_Rn02_00243748 predicted 519
6 SASI_Rn02_00243749 predicted 1297
7 SASI_Rn02_00243750 predicted 1221
8 SASI_Rn02_00243751 predicted 578
9 SASI_Rn02_00243752 predicted 587
10 SASI_Rn02_00243753 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120043 predicted 305
2 SASI_Mm02_00317847 predicted 237
3 SASI_Mm01_00120045 predicted 640
4 SASI_Mm01_00120047 predicted 1243
5 SASI_Mm01_00120048 predicted 549
6 SASI_Mm01_00120049 predicted 494
7 SASI_Mm02_00317848 predicted 1292
8 SASI_Mm01_00120050 predicted 522
9 SASI_Mm01_00120051 predicted 572
10 SASI_Mm01_00120052 predicted 565
11 SASI_Mm01_00120044 predicted 495
12 SASI_Mm01_00120046 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001422
ELF5 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 5 (ets domain transcription factor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001422.2-595s21c1
Sequence:CCGGAGTTCTCATCTATGGGAATTTCTCGAGAAATTCCCATAGATGAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-943s21c1
Sequence:CCGGGACATTCGAAAGGCTTCATTTCTCGAGAAATGAAGCCTTTCGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-1296s21c1
Sequence:CCGGATGATTAGTTTGCAGGTTATGCTCGAGCATAACCTGCAAACTAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-1114s21c1
Sequence:CCGGTTTGTGGTGTCTTGATCAAACCTCGAGGTTTGATCAAGACACCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001422.2-1565s1c1
Sequence:CCGGGCTGGGACTTAATTGGATTTACTCGAGTAAATCCAATTAAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-258s1c1
Sequence:CCGGCCACCCTGAATACTGGACTAACTCGAGTTAGTCCAGTATTCAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-520s1c1
Sequence:CCGGGCTGATTCCAACTGCTTGAAACTCGAGTTTCAAGCAGTTGGAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-775s1c1
Sequence:CCGGGCCCTGAGATACTACTATAAACTCGAGTTTATAGTAGTATCTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-233s1c1
Sequence:CCGGCCTGTGACTCATACTGGACATCTCGAGATGTCCAGTATGAGTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001422
ELF5 MISSION shRNA shRNA Plasmid DNA
E74-like factor 5 (ets domain transcription factor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001422.2-595s21c1
Sequence:CCGGAGTTCTCATCTATGGGAATTTCTCGAGAAATTCCCATAGATGAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-943s21c1
Sequence:CCGGGACATTCGAAAGGCTTCATTTCTCGAGAAATGAAGCCTTTCGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-1296s21c1
Sequence:CCGGATGATTAGTTTGCAGGTTATGCTCGAGCATAACCTGCAAACTAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-1114s21c1
Sequence:CCGGTTTGTGGTGTCTTGATCAAACCTCGAGGTTTGATCAAGACACCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001422.2-1565s1c1
Sequence:CCGGGCTGGGACTTAATTGGATTTACTCGAGTAAATCCAATTAAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-258s1c1
Sequence:CCGGCCACCCTGAATACTGGACTAACTCGAGTTAGTCCAGTATTCAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-520s1c1
Sequence:CCGGGCTGATTCCAACTGCTTGAAACTCGAGTTTCAAGCAGTTGGAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-775s1c1
Sequence:CCGGGCCCTGAGATACTACTATAAACTCGAGTTTATAGTAGTATCTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-233s1c1
Sequence:CCGGCCTGTGACTCATACTGGACATCTCGAGATGTCCAGTATGAGTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001422
ELF5 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 5 (ets domain transcription factor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001422.2-595s21c1
Sequence:CCGGAGTTCTCATCTATGGGAATTTCTCGAGAAATTCCCATAGATGAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-943s21c1
Sequence:CCGGGACATTCGAAAGGCTTCATTTCTCGAGAAATGAAGCCTTTCGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-1296s21c1
Sequence:CCGGATGATTAGTTTGCAGGTTATGCTCGAGCATAACCTGCAAACTAATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001422.2-1114s21c1
Sequence:CCGGTTTGTGGTGTCTTGATCAAACCTCGAGGTTTGATCAAGACACCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001422.2-1565s1c1
Sequence:CCGGGCTGGGACTTAATTGGATTTACTCGAGTAAATCCAATTAAGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-258s1c1
Sequence:CCGGCCACCCTGAATACTGGACTAACTCGAGTTAGTCCAGTATTCAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-520s1c1
Sequence:CCGGGCTGATTCCAACTGCTTGAAACTCGAGTTTCAAGCAGTTGGAATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-775s1c1
Sequence:CCGGGCCCTGAGATACTACTATAAACTCGAGTTTATAGTAGTATCTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001422.2-233s1c1
Sequence:CCGGCCTGTGACTCATACTGGACATCTCGAGATGTCCAGTATGAGTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010125
ELF5 MISSION shRNA Bacterial Glycerol Stock
E74-like factor 5 (ets domain transcription factor)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010125.3-1170s21c1
Sequence:CCGGTGTGACACTGTCTCCTTAATGCTCGAGCATTAAGGAGACAGTGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010125.3-263s21c1
Sequence:CCGGGACATCAGTGCACCCTGAATACTCGAGTATTCAGGGTGCACTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010125.3-937s21c1
Sequence:CCGGATCAGATCAAACTAGACATTTCTCGAGAAATGTCTAGTTTGATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010125.1-204s1c1
Sequence:CCGGGAAGACTACTACCCTGCCTTTCTCGAGAAAGGCAGGGTAGTAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010125.1-1416s1c1
Sequence:CCGGGCCACTAAACTGGGACCTAATCTCGAGATTAGGTCCCAGTTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010125.1-186s1c1
Sequence:CCGGACCGATCTGTTCAGCAATGAACTCGAGTTCATTGCTGAACAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010125
ELF5 MISSION shRNA shRNA Plasmid DNA
E74-like factor 5 (ets domain transcription factor)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010125.3-1170s21c1
Sequence:CCGGTGTGACACTGTCTCCTTAATGCTCGAGCATTAAGGAGACAGTGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010125.3-263s21c1
Sequence:CCGGGACATCAGTGCACCCTGAATACTCGAGTATTCAGGGTGCACTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010125.3-937s21c1
Sequence:CCGGATCAGATCAAACTAGACATTTCTCGAGAAATGTCTAGTTTGATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010125.1-204s1c1
Sequence:CCGGGAAGACTACTACCCTGCCTTTCTCGAGAAAGGCAGGGTAGTAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010125.1-1416s1c1
Sequence:CCGGGCCACTAAACTGGGACCTAATCTCGAGATTAGGTCCCAGTTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010125.1-186s1c1
Sequence:CCGGACCGATCTGTTCAGCAATGAACTCGAGTTCATTGCTGAACAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010125
ELF5 MISSION shRNA Lentiviral Transduction Particles
E74-like factor 5 (ets domain transcription factor)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010125.3-1170s21c1
Sequence:CCGGTGTGACACTGTCTCCTTAATGCTCGAGCATTAAGGAGACAGTGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010125.3-263s21c1
Sequence:CCGGGACATCAGTGCACCCTGAATACTCGAGTATTCAGGGTGCACTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010125.3-937s21c1
Sequence:CCGGATCAGATCAAACTAGACATTTCTCGAGAAATGTCTAGTTTGATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010125.1-204s1c1
Sequence:CCGGGAAGACTACTACCCTGCCTTTCTCGAGAAAGGCAGGGTAGTAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010125.1-1416s1c1
Sequence:CCGGGCCACTAAACTGGGACCTAATCTCGAGATTAGGTCCCAGTTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010125.1-186s1c1
Sequence:CCGGACCGATCTGTTCAGCAATGAACTCGAGTTCATTGCTGAACAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks