EMAIL THIS PAGE TO A FRIEND

ELFN1

extracellular leucine-rich repeat and fibronectin type III domain containing 1

41 Gene Product Result for
Synonyms: PPP1R28
UniProtKB ID: P0C7U0, H3BS57
Gene ID:
Mouse(243312) leucine rich repeat and fibronectin type III, extracellular 1
Rat(288512) extracellular leucine-rich repeat and fibronectin type III domain containing 1
chicken(416465) extracellular leucine-rich repeat and fibronectin type III domain containing 1
dog(489895) extracellular leucine-rich repeat and fibronectin type III domain containing 1
cow(618774) extracellular leucine-rich repeat and fibronectin type III domain containing 1
domestic cat(101090572) extracellular leucine-rich repeat and fibronectin type III domain containing 1
naked mole-rat(101710278) extracellular leucine-rich repeat and fibronectin type III domain containing 1
domestic guinea pig(100734718) extracellular leucine-rich repeat and fibronectin type III domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305830 ANTI-ELFN1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001128636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128636 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002221 MISSION® esiRNA esiRNA targeting mouse Elfn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_374386 Rosetta Predictions human pricing
NM_001105913 Rosetta Predictions rat pricing
NM_175522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254602 predicted 550
2 SASI_Hs01_00254603 predicted 622
3 SASI_Hs01_00254604 predicted 732
4 SASI_Hs01_00254605 predicted 486
5 SASI_Hs01_00254606 predicted 579
6 SASI_Hs01_00254607 predicted 462
7 SASI_Hs01_00254608 predicted 574
8 SASI_Hs01_00254609 predicted 527
9 SASI_Hs01_00254610 predicted 727
10 SASI_Hs01_00254611 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213772 predicted 2330
2 SASI_Rn02_00213773 predicted 960
3 SASI_Rn02_00213774 predicted 1472
4 SASI_Rn02_00213775 predicted 888
5 SASI_Rn02_00213776 predicted 1767
6 SASI_Rn02_00213777 predicted 2792
7 SASI_Rn02_00213778 predicted 1918
8 SASI_Rn02_00213779 predicted 812
9 SASI_Rn02_00213780 predicted 2006
10 SASI_Rn02_00213781 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144719 predicted 620
2 SASI_Mm01_00144720 predicted 817
3 SASI_Mm01_00144721 predicted 1742
4 SASI_Mm01_00144722 predicted 692
5 SASI_Mm01_00144723 predicted 548
6 SASI_Mm01_00144724 predicted 607
7 SASI_Mm01_00144725 predicted 2705
8 SASI_Mm02_00346454 predicted 1481
9 SASI_Mm01_00144726 predicted 1197
10 SASI_Mm01_00144727 predicted 1031
11 SASI_Mm01_00144728 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175522
ELFN1 MISSION shRNA Bacterial Glycerol Stock
extracellular leucine-rich repeat and fibronectin type III domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175522.2-3048s1c1
Sequence:CCGGCCGAGACAGTAGATATACTAACTCGAGTTAGTATATCTACTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-2793s1c1
Sequence:CCGGGACATCCTAGACTACTGGAAACTCGAGTTTCCAGTAGTCTAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-602s1c1
Sequence:CCGGCGGAAACCTCACATACCTCAACTCGAGTTGAGGTATGTGAGGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-2189s1c1
Sequence:CCGGCCCTGTATACAAAGATGCCTTCTCGAGAAGGCATCTTTGTATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-819s1c1
Sequence:CCGGCCCAACATCGTCAACATAGATCTCGAGATCTATGTTGACGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175522.3-1380s21c1
Sequence:CCGGACACGCTGGAGCAGTACAATACTCGAGTATTGTACTGCTCCAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175522.3-1820s21c1
Sequence:CCGGCCTGAGGCTGTGACTCGAATACTCGAGTATTCGAGTCACAGCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175522
ELFN1 MISSION shRNA shRNA Plasmid DNA
extracellular leucine-rich repeat and fibronectin type III domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175522.2-3048s1c1
Sequence:CCGGCCGAGACAGTAGATATACTAACTCGAGTTAGTATATCTACTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-2793s1c1
Sequence:CCGGGACATCCTAGACTACTGGAAACTCGAGTTTCCAGTAGTCTAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-602s1c1
Sequence:CCGGCGGAAACCTCACATACCTCAACTCGAGTTGAGGTATGTGAGGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-2189s1c1
Sequence:CCGGCCCTGTATACAAAGATGCCTTCTCGAGAAGGCATCTTTGTATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-819s1c1
Sequence:CCGGCCCAACATCGTCAACATAGATCTCGAGATCTATGTTGACGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175522.3-1380s21c1
Sequence:CCGGACACGCTGGAGCAGTACAATACTCGAGTATTGTACTGCTCCAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175522.3-1820s21c1
Sequence:CCGGCCTGAGGCTGTGACTCGAATACTCGAGTATTCGAGTCACAGCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175522
ELFN1 MISSION shRNA Lentiviral Transduction Particles
extracellular leucine-rich repeat and fibronectin type III domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109555    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175522.2-3048s1c1
Sequence:CCGGCCGAGACAGTAGATATACTAACTCGAGTTAGTATATCTACTGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-2793s1c1
Sequence:CCGGGACATCCTAGACTACTGGAAACTCGAGTTTCCAGTAGTCTAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-602s1c1
Sequence:CCGGCGGAAACCTCACATACCTCAACTCGAGTTGAGGTATGTGAGGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-2189s1c1
Sequence:CCGGCCCTGTATACAAAGATGCCTTCTCGAGAAGGCATCTTTGTATACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175522.2-819s1c1
Sequence:CCGGCCCAACATCGTCAACATAGATCTCGAGATCTATGTTGACGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175522.3-1380s21c1
Sequence:CCGGACACGCTGGAGCAGTACAATACTCGAGTATTGTACTGCTCCAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175522.3-1820s21c1
Sequence:CCGGCCTGAGGCTGTGACTCGAATACTCGAGTATTCGAGTCACAGCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128636
ELFN1 MISSION shRNA Bacterial Glycerol Stock
extracellular leucine-rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-2531s21c1
Sequence:CCGGAGAAGGTTCAGTTCGCCAAAGCTCGAGCTTTGGCGAACTGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-1238s21c1
Sequence:CCGGTGTTCACGCTCACCAACTACACTCGAGTGTAGTTGGTGAGCGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128636.1-3321s21c1
Sequence:CCGGGTACACTGTAGTCGTTCTATTCTCGAGAATAGAACGACTACAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-587s21c1
Sequence:CCGGAGTGTCCCAACATCGTCAACACTCGAGTGTTGACGATGTTGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-1149s21c1
Sequence:CCGGGATGTACACCCTGGAGCATTTCTCGAGAAATGCTCCAGGGTGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128636
ELFN1 MISSION shRNA shRNA Plasmid DNA
extracellular leucine-rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-2531s21c1
Sequence:CCGGAGAAGGTTCAGTTCGCCAAAGCTCGAGCTTTGGCGAACTGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-1238s21c1
Sequence:CCGGTGTTCACGCTCACCAACTACACTCGAGTGTAGTTGGTGAGCGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128636.1-3321s21c1
Sequence:CCGGGTACACTGTAGTCGTTCTATTCTCGAGAATAGAACGACTACAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-587s21c1
Sequence:CCGGAGTGTCCCAACATCGTCAACACTCGAGTGTTGACGATGTTGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-1149s21c1
Sequence:CCGGGATGTACACCCTGGAGCATTTCTCGAGAAATGCTCCAGGGTGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128636
ELFN1 MISSION shRNA Lentiviral Transduction Particles
extracellular leucine-rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-2531s21c1
Sequence:CCGGAGAAGGTTCAGTTCGCCAAAGCTCGAGCTTTGGCGAACTGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-1238s21c1
Sequence:CCGGTGTTCACGCTCACCAACTACACTCGAGTGTAGTTGGTGAGCGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128636.1-3321s21c1
Sequence:CCGGGTACACTGTAGTCGTTCTATTCTCGAGAATAGAACGACTACAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-587s21c1
Sequence:CCGGAGTGTCCCAACATCGTCAACACTCGAGTGTTGACGATGTTGGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128636.1-1149s21c1
Sequence:CCGGGATGTACACCCTGGAGCATTTCTCGAGAAATGCTCCAGGGTGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks