EMAIL THIS PAGE TO A FRIEND

ELFN2

extracellular leucine-rich repeat and fibronectin type III domain containing 2

81 Gene Product Result for
Synonyms: LRRC62 PPP1R29 dJ63G5.3
UniProtKB ID: Q5R3F8, Q96PY3
Gene ID:
Mouse(207393) leucine rich repeat and fibronectin type III, extracellular 2
Zebrafish(100144404) extracellular leucine-rich repeat and fibronectin type III domain containing 2
domestic cat(101092866) extracellular leucine-rich repeat and fibronectin type III domain containing 2
cow(528562) extracellular leucine-rich repeat and fibronectin type III domain containing 2
Horse(100069756) extracellular leucine-rich repeat and fibronectin type III domain containing 2
dog(481269) extracellular leucine-rich repeat and fibronectin type III domain containing 2
chicken(427906) extracellular leucine-rich repeat and fibronectin type III domain containing 2
sheep(101107857) extracellular leucine-rich repeat and fibronectin type III domain containing 2
domestic guinea pig(101788543) extracellular leucine-rich repeat and fibronectin type III domain containing 2
naked mole-rat(101723566) extracellular leucine-rich repeat and fibronectin type III domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50215 Anti-ELFN2 antibody produced in rabbit affinity isolated antibody horse, human, rat, guinea pig, mouse, rabbit
western blot pricing
HPA000781 ANTI-ELFN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052906 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052906 Rosetta Predictions human pricing
NM_183141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361658 predicted 1811
2 SASI_Hs02_00361659 predicted 1002
3 SASI_Hs02_00361660 predicted 1784
4 SASI_Hs02_00361661 predicted 2583
5 SASI_Hs01_00201350 predicted 1832
6 SASI_Hs02_00361662 predicted 1988
7 SASI_Hs01_00201351 predicted 2266
8 SASI_Hs01_00201352 predicted 984
9 SASI_Hs02_00361663 predicted 1794
10 SASI_Hs01_00201353 predicted 1114
11 SASI_Hs01_00201347 predicted 1191
12 SASI_Hs01_00201348 predicted 261
13 SASI_Hs01_00201349 predicted 896
14 SASI_Hs01_00201354 predicted 1285
15 SASI_Hs01_00201355 predicted 1069
16 SASI_Hs01_00201356 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169943 predicted 2775
2 SASI_Mm01_00169944 predicted 1406
3 SASI_Mm01_00169946 predicted 2010
4 SASI_Mm01_00169947 predicted 1202
5 SASI_Mm01_00169948 predicted 775
6 SASI_Mm01_00169949 predicted 1294
7 SASI_Mm01_00169950 predicted 1340
8 SASI_Mm02_00350163 predicted 1542
9 SASI_Mm01_00169951 predicted 1585
10 SASI_Mm01_00169952 predicted 2495
11 SASI_Mm01_00169945 predicted 856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183141
ELFN2 MISSION shRNA Bacterial Glycerol Stock
extracellular leucine-rich repeat and fibronectin type III domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183141.2-3397s1c1
Sequence:CCGGCCTCTTGTTCAGAGAGGCTATCTCGAGATAGCCTCTCTGAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-2011s1c1
Sequence:CCGGGCTACCAAAGGCAACTATATTCTCGAGAATATAGTTGCCTTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-1470s1c1
Sequence:CCGGCCACCCTTACAGCAAGATGTACTCGAGTACATCTTGCTGTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-2508s1c1
Sequence:CCGGCGACTCCAAGTACATTGAGAACTCGAGTTCTCAATGTACTTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-1815s1c1
Sequence:CCGGCGTCAATGTTAAGAAGACTATCTCGAGATAGTCTTCTTAACATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183141
ELFN2 MISSION shRNA shRNA Plasmid DNA
extracellular leucine-rich repeat and fibronectin type III domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183141.2-3397s1c1
Sequence:CCGGCCTCTTGTTCAGAGAGGCTATCTCGAGATAGCCTCTCTGAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-2011s1c1
Sequence:CCGGGCTACCAAAGGCAACTATATTCTCGAGAATATAGTTGCCTTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-1470s1c1
Sequence:CCGGCCACCCTTACAGCAAGATGTACTCGAGTACATCTTGCTGTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-2508s1c1
Sequence:CCGGCGACTCCAAGTACATTGAGAACTCGAGTTCTCAATGTACTTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-1815s1c1
Sequence:CCGGCGTCAATGTTAAGAAGACTATCTCGAGATAGTCTTCTTAACATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183141
ELFN2 MISSION shRNA Lentiviral Transduction Particles
extracellular leucine-rich repeat and fibronectin type III domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183141.2-3397s1c1
Sequence:CCGGCCTCTTGTTCAGAGAGGCTATCTCGAGATAGCCTCTCTGAACAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-2011s1c1
Sequence:CCGGGCTACCAAAGGCAACTATATTCTCGAGAATATAGTTGCCTTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-1470s1c1
Sequence:CCGGCCACCCTTACAGCAAGATGTACTCGAGTACATCTTGCTGTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-2508s1c1
Sequence:CCGGCGACTCCAAGTACATTGAGAACTCGAGTTCTCAATGTACTTGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183141.2-1815s1c1
Sequence:CCGGCGTCAATGTTAAGAAGACTATCTCGAGATAGTCTTCTTAACATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052906
VALIDATED
ELFN2 MISSION shRNA Bacterial Glycerol Stock
extracellular leucine-rich repeat and fibronectin type III domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-4868s1c1
Sequence:CCGGCCTCCTGTGTTTCTGAGCATTCTCGAGAATGCTCAGAAACACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-614s1c1
Sequence:CCGGCAACAACGTCACCAAGAACTACTCGAGTAGTTCTTGGTGACGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1629s1c1
Sequence:CCGGGACAAGGTCAACCAGATCATTCTCGAGAATGATCTGGTTGACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1640s1c1
Sequence:CCGGCCAGATCATTAACAACTGCATCTCGAGATGCAGTTGTTAATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-3735s1c1
Sequence:CCGGCCAACATCAAACAAAGCACAACTCGAGTTGTGCTTTGTTTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052906.1-983s1c1
Sequence:CCGGGCAGTACAACAACAGCTACTTCTCGAGAAGTAGCTGTTGTTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1019s1c1
Sequence:CCGGCCTCAAGAACAAGAAGGAGATCTCGAGATCTCCTTCTTGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-2249s1c1
Sequence:CCGGCAGACACTACTACTCAGGGTACTCGAGTACCCTGAGTAGTAGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1491s1c1
Sequence:CCGGGTAGCCACCAAAGGCAACTATCTCGAGATAGTTGCCTTTGGTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-4449s1c1
Sequence:CCGGGCTCACTTTGAGGGTGACATTCTCGAGAATGTCACCCTCAAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052906.1-1289s1c1
Sequence:CCGGGCAGAAGTCTGTCAACGTCAACTCGAGTTGACGTTGACAGACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-2654s1c1
Sequence:CCGGCCGACAATAACGGACAGGAAACTCGAGTTTCCTGTCCGTTATTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052906
VALIDATED
ELFN2 MISSION shRNA shRNA Plasmid DNA
extracellular leucine-rich repeat and fibronectin type III domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-4868s1c1
Sequence:CCGGCCTCCTGTGTTTCTGAGCATTCTCGAGAATGCTCAGAAACACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-614s1c1
Sequence:CCGGCAACAACGTCACCAAGAACTACTCGAGTAGTTCTTGGTGACGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1629s1c1
Sequence:CCGGGACAAGGTCAACCAGATCATTCTCGAGAATGATCTGGTTGACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1640s1c1
Sequence:CCGGCCAGATCATTAACAACTGCATCTCGAGATGCAGTTGTTAATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-3735s1c1
Sequence:CCGGCCAACATCAAACAAAGCACAACTCGAGTTGTGCTTTGTTTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052906.1-983s1c1
Sequence:CCGGGCAGTACAACAACAGCTACTTCTCGAGAAGTAGCTGTTGTTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1019s1c1
Sequence:CCGGCCTCAAGAACAAGAAGGAGATCTCGAGATCTCCTTCTTGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-2249s1c1
Sequence:CCGGCAGACACTACTACTCAGGGTACTCGAGTACCCTGAGTAGTAGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1491s1c1
Sequence:CCGGGTAGCCACCAAAGGCAACTATCTCGAGATAGTTGCCTTTGGTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-4449s1c1
Sequence:CCGGGCTCACTTTGAGGGTGACATTCTCGAGAATGTCACCCTCAAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052906.1-1289s1c1
Sequence:CCGGGCAGAAGTCTGTCAACGTCAACTCGAGTTGACGTTGACAGACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-2654s1c1
Sequence:CCGGCCGACAATAACGGACAGGAAACTCGAGTTTCCTGTCCGTTATTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052906
VALIDATED
ELFN2 MISSION shRNA Lentiviral Transduction Particles
extracellular leucine-rich repeat and fibronectin type III domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-4868s1c1
Sequence:CCGGCCTCCTGTGTTTCTGAGCATTCTCGAGAATGCTCAGAAACACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-614s1c1
Sequence:CCGGCAACAACGTCACCAAGAACTACTCGAGTAGTTCTTGGTGACGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1629s1c1
Sequence:CCGGGACAAGGTCAACCAGATCATTCTCGAGAATGATCTGGTTGACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1640s1c1
Sequence:CCGGCCAGATCATTAACAACTGCATCTCGAGATGCAGTTGTTAATGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-3735s1c1
Sequence:CCGGCCAACATCAAACAAAGCACAACTCGAGTTGTGCTTTGTTTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052906.1-983s1c1
Sequence:CCGGGCAGTACAACAACAGCTACTTCTCGAGAAGTAGCTGTTGTTGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1019s1c1
Sequence:CCGGCCTCAAGAACAAGAAGGAGATCTCGAGATCTCCTTCTTGTTCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-2249s1c1
Sequence:CCGGCAGACACTACTACTCAGGGTACTCGAGTACCCTGAGTAGTAGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052906.1-1491s1c1
Sequence:CCGGGTAGCCACCAAAGGCAACTATCTCGAGATAGTTGCCTTTGGTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-4449s1c1
Sequence:CCGGGCTCACTTTGAGGGTGACATTCTCGAGAATGTCACCCTCAAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052906.1-1289s1c1
Sequence:CCGGGCAGAAGTCTGTCAACGTCAACTCGAGTTGACGTTGACAGACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052906.1-2654s1c1
Sequence:CCGGCCGACAATAACGGACAGGAAACTCGAGTTTCCTGTCCGTTATTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks