EMAIL THIS PAGE TO A FRIEND

ELK1

ELK1, member of ETS oncogene family

85 Gene Product Result for
UniProtKB ID: P19419, B2R7H4, O75606, O95058, Q969X8, Q9UJM4
Gene ID:
Human(2002) Summary: This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012]
Mouse(13712) ELK1, member of ETS oncogene family
Rat(314436) ELK1, member of ETS oncogene family
Zebrafish(567895) ELK1, member of ETS oncogene family
dog(491860) ELK1, member of ETS oncogene family
domestic cat(101095156) ELK1, member of ETS oncogene family
cow(786886) ELK1, member of ETS oncogene family
domestic guinea pig(100727907) ELK1, member of ETS oncogene family
naked mole-rat(101725319) ELK1, member of ETS oncogene family
sheep(101113988) ELK1, member of ETS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E3401 Anti-Elk-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4300289 Anti-ELK1 (Ab-383) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4300321 Anti-ELK1 (Ab-389) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry pricing
AV31180 Anti-ELK1 antibody produced in rabbit affinity isolated antibody horse, human, mouse, rabbit, rat, guinea pig, canine, bovine
western blot pricing
AV38589 Anti-ELK1 antibody produced in rabbit IgG fraction of antiserum horse, rabbit, canine, guinea pig, human, mouse, rat
western blot pricing
HPA036084 Anti-ELK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106222 Anti-ELK1 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, human, rat, horse
ELISA, western blot pricing
HPA064381 Anti-ELK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500749 Anti-ELK1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500750 Anti-ELK1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500751 Anti-ELK1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4500752 Anti-ELK1, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
E3526 Anti-phospho-Elk-1 (pSer383) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
western blot pricing
SAB4504390 Anti-phospho-Elk1 (pSer383) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300003 Anti-phospho-ELK1 (pSer383) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4504391 Anti-phospho-Elk1 (pSer389) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300027 Anti-phospho-ELK1 (pSer389) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry pricing
SAB4504392 Anti-phospho-Elk1 (pThr417) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
WH0002002M1 Monoclonal Anti-ELK1 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB5300313 Monoclonal Anti-ELK1 antibody produced in mouse clone 7E10D5, ascites fluid human
ELISA, western blot pricing
PLA0284 Rabbit anti-ELK1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, rabbit, zebrafish, pig, dog, toad, horse, mouse, rat, guinea pig, human
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114123 Rosetta Predictions human pricing
NM_005229 Rosetta Predictions human pricing
NM_001108059 Rosetta Predictions rat pricing
NM_007922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326324 predicted 1791
2 SASI_Hs02_00326325 predicted 1105
3 SASI_Hs02_00326326 predicted 1832
4 SASI_Hs02_00326327 predicted 1740
5 SASI_Hs02_00326328 predicted 1828
6 SASI_Hs02_00326329 predicted 634
7 SASI_Hs02_00326330 predicted 1794
8 SASI_Hs02_00326331 predicted 1380
9 SASI_Hs02_00326332 predicted 2068
10 SASI_Hs02_00326333 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339218 predicted 1687
2 SASI_Hs02_00339219 predicted 998
3 SASI_Hs02_00339220 predicted 1726
4 SASI_Hs02_00339221 predicted 1643
5 SASI_Hs02_00339222 predicted 1723
6 SASI_Hs02_00339223 predicted 519
7 SASI_Hs02_00339224 predicted 1679
8 SASI_Hs02_00339225 predicted 1279
9 SASI_Hs01_00138213 predicted 1963
10 SASI_Hs02_00339226 predicted 1534
11 SASI_Hs01_00138204 predicted 474
12 SASI_Hs01_00138205 predicted 308
13 SASI_Hs01_00138206 predicted 1650
14 SASI_Hs01_00138207 predicted 374
15 SASI_Hs01_00138208 predicted 1418
16 SASI_Hs01_00138209 predicted 463
17 SASI_Hs01_00138210 predicted 1662
18 SASI_Hs01_00138211 predicted 921
19 SASI_Hs01_00138212 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234945 predicted 430
2 SASI_Rn02_00234946 predicted 751
3 SASI_Rn02_00234947 predicted 746
4 SASI_Rn02_00234948 predicted 435
5 SASI_Rn02_00234949 predicted 223
6 SASI_Rn02_00234950 predicted 425
7 SASI_Rn02_00234951 predicted 974
8 SASI_Rn02_00234952 predicted 526
9 SASI_Rn02_00234953 predicted 380
10 SASI_Rn02_00234954 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163817 predicted 384
2 SASI_Mm01_00163818 predicted 797
3 SASI_Mm01_00163819 predicted 1532
4 SASI_Mm01_00163820 predicted 887
5 SASI_Mm01_00163821 predicted 1544
6 SASI_Mm01_00163822 predicted 216
7 SASI_Mm01_00163823 predicted 1383
8 SASI_Mm01_00163824 predicted 875
9 SASI_Mm01_00163825 predicted 1558
10 SASI_Mm01_00163826 predicted 987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005229
VALIDATED
ELK1 MISSION shRNA Bacterial Glycerol Stock
ELK1, member of ETS oncogene family
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-1663s1c1
Sequence:CCGGCCCAAGAGTAACTCTCATTATCTCGAGATAATGAGAGTTACTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005229.2-295s1c1
Sequence:CCGGGCCACATCATCTCCTGGACTTCTCGAGAAGTCCAGGAGATGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-1298s1c1
Sequence:CCGGCCTGCTTCCTACGCATACATTCTCGAGAATGTATGCGTAGGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-990s1c1
Sequence:CCGGCCCAAGGAAGAGTTGGAAGTTCTCGAGAACTTCCAACTCTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1280s21c1
Sequence:CCGGCCCTGCTTCCTACGCATACATCTCGAGATGTATGCGTAGGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005229.3-1961s21c1
Sequence:CCGGGTGAGTAGAAGAGTTAGTTTGCTCGAGCAAACTAACTCTTCTACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-902s21c1
Sequence:CCGGTGAAATCGGAAGAGCTTAATGCTCGAGCATTAAGCTCTTCCGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1388s21c1
Sequence:CCGGCCAAGCTCTCCTTCCAGTTTCCTCGAGGAAACTGGAAGGAGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1002s21c1
Sequence:CCGGGAGAGGGTTTGTGCCAGAAACCTCGAGGTTTCTGGCACAAACCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005229
VALIDATED
ELK1 MISSION shRNA shRNA Plasmid DNA
ELK1, member of ETS oncogene family
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-1663s1c1
Sequence:CCGGCCCAAGAGTAACTCTCATTATCTCGAGATAATGAGAGTTACTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005229.2-295s1c1
Sequence:CCGGGCCACATCATCTCCTGGACTTCTCGAGAAGTCCAGGAGATGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-1298s1c1
Sequence:CCGGCCTGCTTCCTACGCATACATTCTCGAGAATGTATGCGTAGGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-990s1c1
Sequence:CCGGCCCAAGGAAGAGTTGGAAGTTCTCGAGAACTTCCAACTCTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1280s21c1
Sequence:CCGGCCCTGCTTCCTACGCATACATCTCGAGATGTATGCGTAGGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005229.3-1961s21c1
Sequence:CCGGGTGAGTAGAAGAGTTAGTTTGCTCGAGCAAACTAACTCTTCTACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-902s21c1
Sequence:CCGGTGAAATCGGAAGAGCTTAATGCTCGAGCATTAAGCTCTTCCGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1388s21c1
Sequence:CCGGCCAAGCTCTCCTTCCAGTTTCCTCGAGGAAACTGGAAGGAGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1002s21c1
Sequence:CCGGGAGAGGGTTTGTGCCAGAAACCTCGAGGTTTCTGGCACAAACCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005229
VALIDATED
ELK1 MISSION shRNA Lentiviral Transduction Particles
ELK1, member of ETS oncogene family
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-1663s1c1
Sequence:CCGGCCCAAGAGTAACTCTCATTATCTCGAGATAATGAGAGTTACTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005229.2-295s1c1
Sequence:CCGGGCCACATCATCTCCTGGACTTCTCGAGAAGTCCAGGAGATGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-1298s1c1
Sequence:CCGGCCTGCTTCCTACGCATACATTCTCGAGAATGTATGCGTAGGAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005229.2-990s1c1
Sequence:CCGGCCCAAGGAAGAGTTGGAAGTTCTCGAGAACTTCCAACTCTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1280s21c1
Sequence:CCGGCCCTGCTTCCTACGCATACATCTCGAGATGTATGCGTAGGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005229.3-1961s21c1
Sequence:CCGGGTGAGTAGAAGAGTTAGTTTGCTCGAGCAAACTAACTCTTCTACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-902s21c1
Sequence:CCGGTGAAATCGGAAGAGCTTAATGCTCGAGCATTAAGCTCTTCCGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1388s21c1
Sequence:CCGGCCAAGCTCTCCTTCCAGTTTCCTCGAGGAAACTGGAAGGAGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005229.3-1002s21c1
Sequence:CCGGGAGAGGGTTTGTGCCAGAAACCTCGAGGTTTCTGGCACAAACCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007922
ELK1 MISSION shRNA Bacterial Glycerol Stock
ELK1, member of ETS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-1281s1c1
Sequence:CCGGGCTGTCAAAGCTGAACCAGAACTCGAGTTCTGGTTCAGCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007922.3-1791s1c1
Sequence:CCGGCCATCCATCTATGCTCCTGAACTCGAGTTCAGGAGCATAGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-666s1c1
Sequence:CCGGCGGTACTACTATGATAAGAATCTCGAGATTCTTATCATAGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-617s1c1
Sequence:CCGGGCGCAAGAACAAGACCAACATCTCGAGATGTTGGTCTTGTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-941s1c1
Sequence:CCGGCCTCTATTCTACCTTCACAATCTCGAGATTGTGAAGGTAGAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007922
ELK1 MISSION shRNA shRNA Plasmid DNA
ELK1, member of ETS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-1281s1c1
Sequence:CCGGGCTGTCAAAGCTGAACCAGAACTCGAGTTCTGGTTCAGCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007922.3-1791s1c1
Sequence:CCGGCCATCCATCTATGCTCCTGAACTCGAGTTCAGGAGCATAGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-666s1c1
Sequence:CCGGCGGTACTACTATGATAAGAATCTCGAGATTCTTATCATAGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-617s1c1
Sequence:CCGGGCGCAAGAACAAGACCAACATCTCGAGATGTTGGTCTTGTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-941s1c1
Sequence:CCGGCCTCTATTCTACCTTCACAATCTCGAGATTGTGAAGGTAGAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007922
ELK1 MISSION shRNA Lentiviral Transduction Particles
ELK1, member of ETS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-1281s1c1
Sequence:CCGGGCTGTCAAAGCTGAACCAGAACTCGAGTTCTGGTTCAGCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007922.3-1791s1c1
Sequence:CCGGCCATCCATCTATGCTCCTGAACTCGAGTTCAGGAGCATAGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-666s1c1
Sequence:CCGGCGGTACTACTATGATAAGAATCTCGAGATTCTTATCATAGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-617s1c1
Sequence:CCGGGCGCAAGAACAAGACCAACATCTCGAGATGTTGGTCTTGTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007922.3-941s1c1
Sequence:CCGGCCTCTATTCTACCTTCACAATCTCGAGATTGTGAAGGTAGAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks